Incidental Mutation 'R1620:Fscn2'
ID174625
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120366685 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 291 (T291S)
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445] [ENSMUST00000026448]
Predicted Effect probably damaging
Transcript: ENSMUST00000026445
AA Change: T291S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380
AA Change: T291S

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026448
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Meta Mutation Damage Score 0.2997 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y57* probably null Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
bundle UTSW 11 120368026 missense probably damaging 1.00
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2212:Fscn2 UTSW 11 120361591 start gained probably benign
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R2397:Fscn2 UTSW 11 120362169 missense probably damaging 1.00
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4634:Fscn2 UTSW 11 120367720 missense possibly damaging 0.65
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R5780:Fscn2 UTSW 11 120366668 missense probably benign 0.14
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7171:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7538:Fscn2 UTSW 11 120367326 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CAGCCTCTGACAGATGACTTCATGC -3'
(R):5'- GTACCCATTGCCAGTAAGAGCGAC -3'

Sequencing Primer
(F):5'- TGACAGATGACTTCATGCTACCC -3'
(R):5'- gaaccctctctctcaaaacaaac -3'
Posted On2014-04-24