Incidental Mutation 'R1620:Bfar'
Institutional Source Beutler Lab
Gene Symbol Bfar
Ensembl Gene ENSMUSG00000022684
Gene Namebifunctional apoptosis regulator
Synonyms3010001A07Rik, RNF47
MMRRC Submission 039657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosomal Location13671858-13703612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13688846 bp
Amino Acid Change Valine to Phenylalanine at position 187 (V187F)
Ref Sequence ENSEMBL: ENSMUSP00000023365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023365] [ENSMUST00000069281] [ENSMUST00000127973]
Predicted Effect probably damaging
Transcript: ENSMUST00000023365
AA Change: V187F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023365
Gene: ENSMUSG00000022684
AA Change: V187F

RING 34 73 2.71e-6 SMART
transmembrane domain 142 164 N/A INTRINSIC
SAM 179 249 1.82e-6 SMART
transmembrane domain 361 380 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069281
SMART Domains Protein: ENSMUSP00000063371
Gene: ENSMUSG00000022684

RING 34 73 2.71e-6 SMART
low complexity region 86 97 N/A INTRINSIC
PDB:1V85|A 98 123 2e-8 PDB
Blast:SAM 98 124 2e-8 BLAST
transmembrane domain 236 255 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127973
SMART Domains Protein: ENSMUSP00000115585
Gene: ENSMUSG00000022684

RING 34 73 2.71e-6 SMART
transmembrane domain 142 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154568
Meta Mutation Damage Score 0.7647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F398L probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y57* probably null Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 noncoding transcript Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T195A probably benign Het
Lama1 A G 17: 67,767,033 T935A probably benign Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Maip1 T C 1: 57,409,985 probably null Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V8246A possibly damaging Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V356L probably damaging Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Sf3b6 T C 12: 4,826,808 I67T possibly damaging Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D326G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in Bfar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Bfar APN 16 13698963 missense probably benign 0.03
IGL01067:Bfar APN 16 13685241 missense probably damaging 1.00
IGL01532:Bfar APN 16 13687387 splice site probably benign
IGL02727:Bfar APN 16 13688927 critical splice donor site probably null
IGL03189:Bfar APN 16 13687501 missense possibly damaging 0.89
R1167:Bfar UTSW 16 13698894 missense possibly damaging 0.92
R1213:Bfar UTSW 16 13687444 missense possibly damaging 0.89
R1951:Bfar UTSW 16 13702106 missense probably damaging 0.99
R2193:Bfar UTSW 16 13697471 missense probably benign
R4578:Bfar UTSW 16 13687443 missense probably benign 0.20
R4789:Bfar UTSW 16 13685137 start codon destroyed probably null 0.99
R4819:Bfar UTSW 16 13687467 nonsense probably null
R5271:Bfar UTSW 16 13692397 intron probably benign
R6346:Bfar UTSW 16 13702133 missense probably damaging 0.99
R7186:Bfar UTSW 16 13692507 missense probably benign
R7758:Bfar UTSW 16 13702121 missense possibly damaging 0.66
X0021:Bfar UTSW 16 13687587 missense probably benign 0.25
Z1088:Bfar UTSW 16 13697460 missense probably damaging 0.99
Z1177:Bfar UTSW 16 13688810 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgagggagaagaagtgaggg -3'
Posted On2014-04-24