Incidental Mutation 'R1621:Cd38'
ID174654
Institutional Source Beutler Lab
Gene Symbol Cd38
Ensembl Gene ENSMUSG00000029084
Gene NameCD38 antigen
SynonymsCd38-rs1
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43868553-43912375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43901524 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 160 (D160G)
Ref Sequence ENSEMBL: ENSMUSP00000030964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030964]
PDB Structure
Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030964
AA Change: D160G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084
AA Change: D160G

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Rib_hydrolayse 59 300 2.9e-104 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Cd38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Cd38 APN 5 43903597 missense probably benign 0.04
IGL01691:Cd38 APN 5 43903586 splice site probably benign
IGL02585:Cd38 APN 5 43910302 missense probably damaging 1.00
paradiso UTSW 5 43903585 splice site probably null
IGL02796:Cd38 UTSW 5 43906213 missense probably damaging 1.00
R0496:Cd38 UTSW 5 43868891 missense probably damaging 1.00
R0855:Cd38 UTSW 5 43903585 splice site probably null
R2353:Cd38 UTSW 5 43908011 critical splice donor site probably null
R2366:Cd38 UTSW 5 43903590 splice site probably benign
R2860:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R2861:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R4342:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4343:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4344:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4953:Cd38 UTSW 5 43907545 missense possibly damaging 0.73
R5007:Cd38 UTSW 5 43906164 missense probably damaging 1.00
R5371:Cd38 UTSW 5 43868883 missense probably benign 0.01
R5699:Cd38 UTSW 5 43900386 missense probably damaging 1.00
R6857:Cd38 UTSW 5 43906198 missense probably damaging 0.99
R6945:Cd38 UTSW 5 43908006 missense probably damaging 1.00
R7129:Cd38 UTSW 5 43910309 missense probably benign 0.13
R7825:Cd38 UTSW 5 43901455 missense probably damaging 1.00
R7852:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7855:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7894:Cd38 UTSW 5 43900404 missense probably damaging 1.00
R7935:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7938:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7977:Cd38 UTSW 5 43900404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGAACAGAGGAGGTCTGTG -3'
(R):5'- GAGCCCAGTTTGTCACTAAGGTCAC -3'

Sequencing Primer
(F):5'- cactcaatctactgctgaccc -3'
(R):5'- TGTCACTAAGGTCACTGATGG -3'
Posted On2014-04-24