Incidental Mutation 'R1621:Prl6a1'
ID174676
Institutional Source Beutler Lab
Gene Symbol Prl6a1
Ensembl Gene ENSMUSG00000069259
Gene Nameprolactin family 6, subfamily a, member 1
SynonymsPLP-B, Prlpb
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27312627-27319252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27318010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 120 (T120I)
Ref Sequence ENSEMBL: ENSMUSP00000089269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091679] [ENSMUST00000091680]
Predicted Effect probably benign
Transcript: ENSMUST00000091679
AA Change: T125I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000089268
Gene: ENSMUSG00000069259
AA Change: T125I

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Hormone_1 21 235 8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091680
AA Change: T120I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000089269
Gene: ENSMUSG00000069259
AA Change: T120I

DomainStartEndE-ValueType
Pfam:Hormone_1 16 230 1.1e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119758
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Prl6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Prl6a1 APN 13 27316364 missense possibly damaging 0.72
IGL01688:Prl6a1 APN 13 27317986 missense probably damaging 1.00
IGL01922:Prl6a1 APN 13 27315360 missense possibly damaging 0.57
IGL02059:Prl6a1 APN 13 27315365 missense probably benign 0.02
IGL03170:Prl6a1 APN 13 27315423 missense possibly damaging 0.95
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0049:Prl6a1 UTSW 13 27317997 missense probably damaging 0.99
R0606:Prl6a1 UTSW 13 27314194 intron probably benign
R0944:Prl6a1 UTSW 13 27318166 splice site probably benign
R1518:Prl6a1 UTSW 13 27318927 missense possibly damaging 0.72
R1518:Prl6a1 UTSW 13 27318928 missense probably null 0.19
R1566:Prl6a1 UTSW 13 27315427 missense possibly damaging 0.84
R2011:Prl6a1 UTSW 13 27315369 missense probably benign 0.00
R2058:Prl6a1 UTSW 13 27319098 missense probably benign 0.05
R2937:Prl6a1 UTSW 13 27315320 missense probably damaging 0.98
R3079:Prl6a1 UTSW 13 27319000 missense possibly damaging 0.71
R4685:Prl6a1 UTSW 13 27316324 missense probably benign 0.00
R4856:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R4886:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R5495:Prl6a1 UTSW 13 27312671 missense possibly damaging 0.95
R5923:Prl6a1 UTSW 13 27316363 missense probably benign 0.08
R6772:Prl6a1 UTSW 13 27319048 missense probably damaging 1.00
R7411:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R7501:Prl6a1 UTSW 13 27316299 missense possibly damaging 0.69
R7549:Prl6a1 UTSW 13 27318971 missense probably damaging 0.96
R7563:Prl6a1 UTSW 13 27314238 critical splice donor site probably null
R7773:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R8024:Prl6a1 UTSW 13 27318695 intron probably benign
Z1177:Prl6a1 UTSW 13 27315321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAAGAGCAGTGCTACCACC -3'
(R):5'- GAGTGCATACCTTGCTGAGTATCCC -3'

Sequencing Primer
(F):5'- CAGGTCCTGTATCTGCTAGATGTAAC -3'
(R):5'- GCTGAGTATCCCTCTAAGAGC -3'
Posted On2014-04-24