Incidental Mutation 'R1621:Fhod3'
ID174682
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1621 (G1)
Quality Score96
Status Not validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25022867 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 514 (I514K)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably benign
Transcript: ENSMUST00000037097
AA Change: I514K

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: I514K

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
R7588:Fhod3 UTSW 18 25090248 missense probably benign 0.02
R7629:Fhod3 UTSW 18 24754317 missense probably benign 0.08
R7667:Fhod3 UTSW 18 25001944 missense probably benign
R7681:Fhod3 UTSW 18 24990038 missense probably damaging 1.00
R7829:Fhod3 UTSW 18 25115890 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTCTGCACTCCATACCACCTCAAG -3'
(R):5'- TCTCCTTAGCTCACACAGGTGACTC -3'

Sequencing Primer
(F):5'- GTCCCACCTCACAGGGAAG -3'
(R):5'- TGAGTGAGTCCTTGCAACAC -3'
Posted On2014-04-24