Incidental Mutation 'R1622:Cdh4'
ID 174692
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, Rcad, R-cadherin
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1622 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 179442431-179899373 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 179889092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 589 (I589T)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000098996]
AlphaFold P39038
Predicted Effect possibly damaging
Transcript: ENSMUST00000000314
AA Change: I589T

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: I589T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129659
Meta Mutation Damage Score 0.1514 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
R7514:Cdh4 UTSW 2 179890843 missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179444810 splice site probably null
R7560:Cdh4 UTSW 2 179890902 missense probably benign 0.25
R8146:Cdh4 UTSW 2 179874078 missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179894035 missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179860147 missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179780403 missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179780326 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TGCCTAGCCTTGCTGAGAACTGTC -3'
(R):5'- TCTCCCCAGCCTGTATGAACAGTC -3'

Sequencing Primer
(F):5'- CTTGTAGAAGAGAAGGCATTCTCCC -3'
(R):5'- GGCTGGACCCTAAATACTTAGCTC -3'
Posted On 2014-04-24