Incidental Mutation 'R1622:Gabra4'
ID174698
Institutional Source Beutler Lab
Gene Symbol Gabra4
Ensembl Gene ENSMUSG00000029211
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
SynonymsGabra-4
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1622 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location71569749-71658308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71571986 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 484 (S484P)
Ref Sequence ENSEMBL: ENSMUSP00000143675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031121] [ENSMUST00000197994] [ENSMUST00000198138] [ENSMUST00000199357]
Predicted Effect probably benign
Transcript: ENSMUST00000031121
AA Change: S458P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031121
Gene: ENSMUSG00000029211
AA Change: S458P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 256 8.8e-52 PFAM
Pfam:Neur_chan_memb 263 536 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197994
Predicted Effect probably benign
Transcript: ENSMUST00000198138
SMART Domains Protein: ENSMUSP00000142466
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 53 69 3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199357
AA Change: S484P

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143675
Gene: ENSMUSG00000029211
AA Change: S484P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 91 282 1.7e-45 PFAM
Pfam:Neur_chan_memb 289 562 3.3e-44 PFAM
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Gabra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Gabra4 APN 5 71633629 missense probably damaging 1.00
IGL01503:Gabra4 APN 5 71641086 missense possibly damaging 0.60
IGL02028:Gabra4 APN 5 71633596 missense probably damaging 1.00
IGL02688:Gabra4 APN 5 71572167 missense probably benign
IGL02749:Gabra4 APN 5 71638147 missense probably benign 0.42
IGL03095:Gabra4 APN 5 71624015 missense probably damaging 1.00
IGL03330:Gabra4 APN 5 71641064 missense probably null 1.00
E0354:Gabra4 UTSW 5 71640861 missense probably damaging 1.00
PIT4142001:Gabra4 UTSW 5 71571763 missense probably damaging 1.00
R1523:Gabra4 UTSW 5 71633632 missense probably damaging 1.00
R1689:Gabra4 UTSW 5 71633542 splice site probably null
R1930:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1931:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1967:Gabra4 UTSW 5 71572069 missense possibly damaging 0.87
R2095:Gabra4 UTSW 5 71624112 missense probably damaging 0.99
R2131:Gabra4 UTSW 5 71641224 missense probably benign 0.00
R2698:Gabra4 UTSW 5 71572078 missense probably benign 0.03
R3884:Gabra4 UTSW 5 71657257 missense probably benign 0.33
R3924:Gabra4 UTSW 5 71642253 splice site probably benign
R4029:Gabra4 UTSW 5 71572189 missense probably benign 0.31
R4361:Gabra4 UTSW 5 71633545 critical splice donor site probably null
R4659:Gabra4 UTSW 5 71641144 missense probably damaging 1.00
R4682:Gabra4 UTSW 5 71657809 start codon destroyed probably null 0.74
R4810:Gabra4 UTSW 5 71623982 missense probably damaging 1.00
R4888:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5093:Gabra4 UTSW 5 71640864 missense probably damaging 1.00
R5121:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5889:Gabra4 UTSW 5 71571891 missense possibly damaging 0.61
R5906:Gabra4 UTSW 5 71623910 missense probably benign 0.00
R6574:Gabra4 UTSW 5 71623925 missense probably benign
R7068:Gabra4 UTSW 5 71572059 missense probably benign 0.07
R7571:Gabra4 UTSW 5 71571992 missense probably benign
R7815:Gabra4 UTSW 5 71657809 start codon destroyed possibly damaging 0.54
R7817:Gabra4 UTSW 5 71640863 missense probably damaging 1.00
R7840:Gabra4 UTSW 5 71640913 splice site probably null
R7899:Gabra4 UTSW 5 71657995 unclassified probably benign
R8000:Gabra4 UTSW 5 71623961 missense probably damaging 1.00
R8057:Gabra4 UTSW 5 71623952 missense probably benign 0.12
Z1176:Gabra4 UTSW 5 71623895 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AACCCAGTAGACCATGTTAAATGCTCC -3'
(R):5'- TGAGGTGGGAAATCACTCCAGCAAG -3'

Sequencing Primer
(F):5'- AAATGCTCCAAATGTGACTGG -3'
(R):5'- CTCCAGCAAGACCAGCG -3'
Posted On2014-04-24