Incidental Mutation 'R1622:Prss58'
ID174700
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Nameprotease, serine 58
SynonymsBC048599
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1622 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40895270-40900387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40897314 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 143 (C143S)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063523
AA Change: C143S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: C143S

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Meta Mutation Damage Score 0.1787 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40895465 missense probably damaging 1.00
IGL01108:Prss58 APN 6 40897344 missense probably damaging 1.00
IGL01645:Prss58 APN 6 40897310 missense probably damaging 0.98
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R2511:Prss58 UTSW 6 40897800 missense probably damaging 1.00
R4292:Prss58 UTSW 6 40897310 missense probably damaging 0.98
R5093:Prss58 UTSW 6 40897817 missense probably damaging 1.00
R5601:Prss58 UTSW 6 40897849 missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40897769 missense probably damaging 1.00
R6806:Prss58 UTSW 6 40897732 missense probably damaging 0.98
R7105:Prss58 UTSW 6 40897766 missense probably damaging 1.00
R7136:Prss58 UTSW 6 40900053 critical splice donor site probably null
R7344:Prss58 UTSW 6 40895465 missense probably damaging 1.00
R7699:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7700:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7954:Prss58 UTSW 6 40895609 missense possibly damaging 0.92
R8305:Prss58 UTSW 6 40895660 missense probably benign 0.00
R8370:Prss58 UTSW 6 40895424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTGAGACGAAAATAGAGTCCTGT -3'
(R):5'- GCACACTGCAATTTACCGTGAGTGATA -3'

Sequencing Primer
(F):5'- GACGAAAATAGAGTCCTGTTACAC -3'
(R):5'- TGAGTTCTCAGGTCACACATAGAC -3'
Posted On2014-04-24