Incidental Mutation 'R1622:Rassf8'
ID174701
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R1622 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 145820103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably benign
Transcript: ENSMUST00000032388
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000058538
AA Change: D53G
Predicted Effect probably benign
Transcript: ENSMUST00000111704
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
R8409:Rassf8 UTSW 6 145815703 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTACATGTCAGAGGGGTACAG -3'
(R):5'- TTGGGAAGCACACAGAGCATCG -3'

Sequencing Primer
(F):5'- ACAGTGGGTTACCTCACTTTG -3'
(R):5'- GGCAATGTCCAATGCTAACTG -3'
Posted On2014-04-24