Mutagenetix > Incidental Mutations

Incidental Mutation 'R1622:Rassf8'

174701

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

039659-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R1622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 145820103 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably benign
Transcript: ENSMUST00000032388

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000058538
AA Change: D53G

Predicted Effect

probably benign
Transcript: ENSMUST00000111704

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldoart2	A	G	12: 55,565,911	E207G	probably benign	Het
Arhgap19	T	A	19: 41,801,973	S19C	probably benign	Het
Arhgef18	T	A	8: 3,441,272	D374E	possibly damaging	Het
Atf2	A	G	2: 73,853,789		probably null	Het
C130026I21Rik	A	G	1: 85,254,186		probably benign	Het
Cadm1	A	G	9: 47,813,841	N300S	probably benign	Het
Ccdc159	A	T	9: 21,929,370	I78F	possibly damaging	Het
Cdh4	T	C	2: 179,889,092	I589T	possibly damaging	Het
Clstn1	T	C	4: 149,629,407	I182T	probably damaging	Het
Cnga3	T	A	1: 37,244,828		probably benign	Het
Cntln	T	A	4: 85,063,181	S865R	probably damaging	Het
Col5a3	C	T	9: 20,772,220	G1552E	unknown	Het
Col6a4	A	C	9: 105,997,135	S2218A	probably benign	Het
Ephb1	T	C	9: 102,001,711	T527A	probably benign	Het
Fkbp15	T	A	4: 62,323,202	I569F	possibly damaging	Het
Gabra4	A	G	5: 71,571,986	S484P	possibly damaging	Het
Glce	T	C	9: 62,070,561	I14V	possibly damaging	Het
Gm4884	A	T	7: 41,042,841	Q78L	probably damaging	Het
Gpn1	A	G	5: 31,503,404	T180A	possibly damaging	Het
Gpr6	A	T	10: 41,071,292	I98N	probably damaging	Het
Hcrtr2	T	C	9: 76,323,440	N22S	probably benign	Het
Hfm1	C	T	5: 106,893,523	V665I	possibly damaging	Het
Il4ra	T	A	7: 125,570,053	I159N	possibly damaging	Het
Irf8	G	C	8: 120,739,822	C2S	possibly damaging	Het
Itih2	A	T	2: 10,102,079	N701K	probably benign	Het
Lrrc4b	GAGAAG	GAG	7: 44,462,230		probably benign	Het
Mmp10	T	A	9: 7,504,995	Y263*	probably null	Het
Morc3	T	A	16: 93,874,806	M835K	probably benign	Het
Msh3	A	G	13: 92,344,954		probably null	Het
Ncbp1	A	G	4: 46,171,963	H777R	possibly damaging	Het
Nfatc1	A	G	18: 80,666,967	M514T	probably damaging	Het
Nlrp3	T	A	11: 59,548,476	I293N	probably damaging	Het
Pank2	A	T	2: 131,273,969	E102D	probably damaging	Het
Pbrm1	A	G	14: 31,032,548	D175G	probably benign	Het
Pcdh9	T	C	14: 93,885,875	D953G	probably benign	Het
Pibf1	G	A	14: 99,186,481	V497I	probably benign	Het
Pkd1	G	A	17: 24,581,640	M3085I	probably benign	Het
Prss58	A	T	6: 40,897,314	C143S	possibly damaging	Het
Spag7	T	A	11: 70,664,862	D73V	probably damaging	Het
Sult3a1	A	T	10: 33,870,250	M189L	probably benign	Het
Syt4	T	C	18: 31,444,016	D95G	probably damaging	Het
Tbc1d8	A	C	1: 39,380,236	S766A	probably benign	Het
Tmco5	A	T	2: 116,880,315	M39L	probably benign	Het
Trcg1	A	G	9: 57,248,672	N797S	possibly damaging	Het
Trim34a	A	T	7: 104,261,338		probably null	Het
Ubr5	T	C	15: 38,009,113		probably benign	Het
Urb2	A	G	8: 124,029,624	N690S	probably benign	Het
Zfp445	A	G	9: 122,852,549	Y776H	possibly damaging	Het
Zfp52	G	A	17: 21,561,571	M560I	probably benign	Het
Zfp608	A	G	18: 54,988,294	S74P	probably benign	Het
Zfp629	A	G	7: 127,611,840	C266R	probably damaging	Het
Zscan2	A	G	7: 80,875,386	K285R	probably benign	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTACATGTCAGAGGGGTACAG -3'
(R):5'- TTGGGAAGCACACAGAGCATCG -3'

Sequencing Primer
(F):5'- ACAGTGGGTTACCTCACTTTG -3'
(R):5'- GGCAATGTCCAATGCTAACTG -3'

Posted On

2014-04-24