Incidental Mutation 'R1622:Gpr6'
ID174724
Institutional Source Beutler Lab
Gene Symbol Gpr6
Ensembl Gene ENSMUSG00000046922
Gene NameG protein-coupled receptor 6
Synonyms
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1622 (G1)
Quality Score222
Status Validated
Chromosome10
Chromosomal Location41069977-41072285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41071292 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 98 (I98N)
Ref Sequence ENSEMBL: ENSMUSP00000057323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061796]
Predicted Effect probably damaging
Transcript: ENSMUST00000061796
AA Change: I98N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057323
Gene: ENSMUSG00000046922
AA Change: I98N

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
Pfam:7tm_1 90 330 2.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213704
Meta Mutation Damage Score 0.9283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Gpr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Gpr6 APN 10 41070816 missense probably damaging 0.99
IGL01010:Gpr6 APN 10 41071151 missense probably benign
IGL01098:Gpr6 APN 10 41070743 missense probably damaging 1.00
IGL01323:Gpr6 APN 10 41071559 missense possibly damaging 0.96
R1153:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1154:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1628:Gpr6 UTSW 10 41071548 missense possibly damaging 0.96
R1638:Gpr6 UTSW 10 41070534 missense probably benign 0.02
R1935:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R1936:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R2108:Gpr6 UTSW 10 41070653 missense possibly damaging 0.79
R2129:Gpr6 UTSW 10 41071172 missense possibly damaging 0.50
R4024:Gpr6 UTSW 10 41071268 missense probably damaging 1.00
R4237:Gpr6 UTSW 10 41070608 missense probably damaging 1.00
R4418:Gpr6 UTSW 10 41070608 missense probably damaging 1.00
R4703:Gpr6 UTSW 10 41071041 missense probably damaging 1.00
R4814:Gpr6 UTSW 10 41071262 missense possibly damaging 0.94
R6821:Gpr6 UTSW 10 41071008 missense probably benign 0.04
R7190:Gpr6 UTSW 10 41070960 missense probably damaging 1.00
R7573:Gpr6 UTSW 10 41070872 missense probably damaging 0.99
R7574:Gpr6 UTSW 10 41070656 missense possibly damaging 0.47
R7611:Gpr6 UTSW 10 41070879 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGGTCAACTGTGATAGCAAGCAGG -3'
(R):5'- AGCAACATCTAGCGGCGATGAAC -3'

Sequencing Primer
(F):5'- TAGCAAGCAGGCTGCTGAC -3'
(R):5'- TCAACGAGTCCCAAGTGGTG -3'
Posted On2014-04-24