Incidental Mutation 'R1622:Nlrp3'
ID 174726
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 039659-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1622 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59439302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 293 (I293N)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: I293N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: I293N

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: I293N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: I293N

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.9140 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,612,696 (GRCm39) E207G probably benign Het
Arhgap19 T A 19: 41,790,412 (GRCm39) S19C probably benign Het
Arhgef18 T A 8: 3,491,272 (GRCm39) D374E possibly damaging Het
Atf2 A G 2: 73,684,133 (GRCm39) probably null Het
Cadm1 A G 9: 47,725,139 (GRCm39) N300S probably benign Het
Ccdc159 A T 9: 21,840,666 (GRCm39) I78F possibly damaging Het
Cdh4 T C 2: 179,530,885 (GRCm39) I589T possibly damaging Het
Clstn1 T C 4: 149,713,864 (GRCm39) I182T probably damaging Het
Cnga3 T A 1: 37,283,909 (GRCm39) probably benign Het
Cntln T A 4: 84,981,418 (GRCm39) S865R probably damaging Het
Col5a3 C T 9: 20,683,516 (GRCm39) G1552E unknown Het
Col6a4 A C 9: 105,874,334 (GRCm39) S2218A probably benign Het
Ephb1 T C 9: 101,878,910 (GRCm39) T527A probably benign Het
Fkbp15 T A 4: 62,241,439 (GRCm39) I569F possibly damaging Het
Gabra4 A G 5: 71,729,329 (GRCm39) S484P possibly damaging Het
Glce T C 9: 61,977,843 (GRCm39) I14V possibly damaging Het
Gm4884 A T 7: 40,692,265 (GRCm39) Q78L probably damaging Het
Gpn1 A G 5: 31,660,748 (GRCm39) T180A possibly damaging Het
Gpr6 A T 10: 40,947,288 (GRCm39) I98N probably damaging Het
Hcrtr2 T C 9: 76,230,722 (GRCm39) N22S probably benign Het
Hfm1 C T 5: 107,041,389 (GRCm39) V665I possibly damaging Het
Il4ra T A 7: 125,169,225 (GRCm39) I159N possibly damaging Het
Irf8 G C 8: 121,466,561 (GRCm39) C2S possibly damaging Het
Itih2 A T 2: 10,106,890 (GRCm39) N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,111,654 (GRCm39) probably benign Het
Mmp10 T A 9: 7,504,996 (GRCm39) Y263* probably null Het
Morc3 T A 16: 93,671,694 (GRCm39) M835K probably benign Het
Msh3 A G 13: 92,481,462 (GRCm39) probably null Het
Ncbp1 A G 4: 46,171,963 (GRCm39) H777R possibly damaging Het
Nfatc1 A G 18: 80,710,182 (GRCm39) M514T probably damaging Het
Pank2 A T 2: 131,115,889 (GRCm39) E102D probably damaging Het
Pbrm1 A G 14: 30,754,505 (GRCm39) D175G probably benign Het
Pcdh9 T C 14: 94,123,311 (GRCm39) D953G probably benign Het
Pibf1 G A 14: 99,423,917 (GRCm39) V497I probably benign Het
Pkd1 G A 17: 24,800,614 (GRCm39) M3085I probably benign Het
Prss58 A T 6: 40,874,248 (GRCm39) C143S possibly damaging Het
Rassf8 A G 6: 145,765,829 (GRCm39) probably benign Het
Sp140l2 A G 1: 85,231,907 (GRCm39) probably benign Het
Spag7 T A 11: 70,555,688 (GRCm39) D73V probably damaging Het
Sult3a1 A T 10: 33,746,246 (GRCm39) M189L probably benign Het
Syt4 T C 18: 31,577,069 (GRCm39) D95G probably damaging Het
Tbc1d8 A C 1: 39,419,317 (GRCm39) S766A probably benign Het
Tmco5 A T 2: 116,710,796 (GRCm39) M39L probably benign Het
Trcg1 A G 9: 57,155,955 (GRCm39) N797S possibly damaging Het
Trim34a A T 7: 103,910,545 (GRCm39) probably null Het
Ubr5 T C 15: 38,009,357 (GRCm39) probably benign Het
Urb2 A G 8: 124,756,363 (GRCm39) N690S probably benign Het
Zfp445 A G 9: 122,681,614 (GRCm39) Y776H possibly damaging Het
Zfp52 G A 17: 21,781,833 (GRCm39) M560I probably benign Het
Zfp608 A G 18: 55,121,366 (GRCm39) S74P probably benign Het
Zfp629 A G 7: 127,211,012 (GRCm39) C266R probably damaging Het
Zscan2 A G 7: 80,525,134 (GRCm39) K285R probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGCACTGGGAAAGCTCTTCAAAGAC -3'
(R):5'- CCTTCCTTTTGGCCTCAGAGAAACC -3'

Sequencing Primer
(F):5'- CAAGGAGTCTAGCAGACCTGAT -3'
(R):5'- CTAGGATCTCCACATGGCG -3'
Posted On 2014-04-24