Incidental Mutation 'R1622:Msh3'
ID174730
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R1622 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92344954 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000022220] [ENSMUST00000022220] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000185852] [ENSMUST00000185852] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably null
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189376
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACTGCCACCATTTTCAATGGCAC -3'
(R):5'- TTCAGCGAAGAGACGCCATGCAAC -3'

Sequencing Primer
(F):5'- GGCACATAGTCTGAACAATCTG -3'
(R):5'- CAACTGTGACTGTCCTTGGAAG -3'
Posted On2014-04-24