Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Olfr424'

174747

Institutional Source

Beutler Lab

Gene Symbol

Olfr424

Ensembl Gene

ENSMUSG00000051528

Gene Name

olfactory receptor 424

Synonyms

MOR105-2, GA_x6K02T2P20D-21025190-21024243

MMRRC Submission

039660-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R1623 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

174131517-174138257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 174137317 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 191 (D191V)

Ref Sequence

ENSEMBL: ENSMUSP00000150840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053941] [ENSMUST00000214751]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053941
AA Change: D191V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000054305
Gene: ENSMUSG00000051528
AA Change: D191V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	6.1e-63	PFAM
Pfam:7tm_1	41	289	1.8e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192471

Predicted Effect

probably damaging
Transcript: ENSMUST00000214751
AA Change: D191V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218625

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Actn2	A	T	13: 12,340,439	I21N	probably benign	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hivep3	T	C	4: 120,095,704	S406P	possibly damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mical3	C	T	6: 121,024,807	V575M	probably damaging	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rad18	C	T	6: 112,628,519	S398N	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trdn	A	G	10: 33,258,102	K333R	possibly damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Olfr424

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01453:Olfr424	APN	1	174137113	missense	possibly damaging	0.46
IGL01651:Olfr424	APN	1	174137341	missense	probably damaging	0.96
R0194:Olfr424	UTSW	1	174136761	missense	probably benign	0.04
R0357:Olfr424	UTSW	1	174137299	nonsense	probably null
R0732:Olfr424	UTSW	1	174137415	missense	possibly damaging	0.85
R1103:Olfr424	UTSW	1	174136891	missense	probably benign	0.07
R1829:Olfr424	UTSW	1	174137194	missense	probably benign	0.12
R6617:Olfr424	UTSW	1	174137248	missense	probably damaging	1.00
R7060:Olfr424	UTSW	1	174136810	missense	probably benign	0.00
R7203:Olfr424	UTSW	1	174137114	nonsense	probably null
R7625:Olfr424	UTSW	1	174137167	missense	probably benign	0.13
R7994:Olfr424	UTSW	1	174136707	start gained	probably benign
R8035:Olfr424	UTSW	1	174136924	missense	probably damaging	1.00
R8127:Olfr424	UTSW	1	174137589	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGGATACCCGTCTTCACAACCC -3'
(R):5'- GCAGCACAAGTAGAGAAAGCCTTCC -3'

Sequencing Primer
(F):5'- CCATTCACTTGGAAATTCAGAGGG -3'
(R):5'- CGACGGCCTTCACCAGAG -3'

Posted On

2014-04-24