Incidental Mutation 'R1623:Pnpla7'
ID174750
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Namepatatin-like phospholipase domain containing 7
SynonymsNRE, E430013P11Rik
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1623 (G1)
Quality Score208
Status Not validated
Chromosome2
Chromosomal Location24976033-25054057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25052599 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 132 (V132A)
Ref Sequence ENSEMBL: ENSMUSP00000115952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000137913] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000155601]
Predicted Effect probably benign
Transcript: ENSMUST00000006646
SMART Domains Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 361 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045295
AA Change: V1265A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: V1265A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074422
SMART Domains Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100334
SMART Domains Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
low complexity region 363 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102931
SMART Domains Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114386
SMART Domains Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 310 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114388
SMART Domains Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116574
SMART Domains Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132082
Predicted Effect probably benign
Transcript: ENSMUST00000132172
SMART Domains Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134744
SMART Domains Protein: ENSMUSP00000120376
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135328
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140733
Predicted Effect probably benign
Transcript: ENSMUST00000140737
SMART Domains Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141866
Predicted Effect probably benign
Transcript: ENSMUST00000144520
SMART Domains Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152122
SMART Domains Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:IQ 62 80 2.5e-4 PFAM
low complexity region 114 125 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154359
Predicted Effect probably damaging
Transcript: ENSMUST00000155601
AA Change: V132A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175104
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24976315 critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24980224 missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 25016563 missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 25050893 missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 25050973 critical splice donor site probably null
IGL02280:Pnpla7 APN 2 25011577 missense probably benign 0.00
IGL02629:Pnpla7 APN 2 25050945 missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 25050276 missense probably benign 0.24
IGL02931:Pnpla7 APN 2 25015229 missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 25015289 unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 25042139 missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0309:Pnpla7 UTSW 2 24987195 missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24995293 missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 25052301 splice site probably null
R0565:Pnpla7 UTSW 2 24980117 splice site probably benign
R0830:Pnpla7 UTSW 2 24997255 missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24982123 missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24997240 missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 25050953 missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24996165 missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 25047708 missense probably benign 0.01
R1572:Pnpla7 UTSW 2 25015251 missense possibly damaging 0.69
R1876:Pnpla7 UTSW 2 25040973 missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 25053784 unclassified probably benign
R1909:Pnpla7 UTSW 2 24997288 missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 25016617 missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 25051598 unclassified probably benign
R2381:Pnpla7 UTSW 2 24980758 missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 25052318 missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 25042138 missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24982114 missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 25051704 nonsense probably null
R4573:Pnpla7 UTSW 2 25050873 missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 25052317 missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4893:Pnpla7 UTSW 2 25053676 nonsense probably null
R4941:Pnpla7 UTSW 2 24997264 unclassified probably null
R5116:Pnpla7 UTSW 2 25021970 missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24980044 missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 25041103 missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 25050309 missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24997300 missense probably benign 0.06
R5288:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 25021952 missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 25002937 missense probably benign 0.10
R5384:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 25019441 missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 25003001 missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 25052384 missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24981778 missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 25011649 missense probably benign
R6284:Pnpla7 UTSW 2 25016618 missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 25011564 missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 25016538 missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 25051615 missense probably damaging 1.00
R7503:Pnpla7 UTSW 2 24983532 nonsense probably null
R7526:Pnpla7 UTSW 2 24998666 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGGGCGGACAGTGTTTGACATC -3'
(R):5'- CCCATTGCAGGGTTGTAGATCAGAG -3'

Sequencing Primer
(F):5'- TCCTAGAGAAGATGTTGCAGGAC -3'
(R):5'- CTCTGGGTCTTGACACATGG -3'
Posted On2014-04-24