Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Hivep3'

174772

Institutional Source

Beutler Lab

Gene Symbol

Hivep3

Ensembl Gene

ENSMUSG00000028634

Gene Name

human immunodeficiency virus type I enhancer binding protein 3

Synonyms

E030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc

MMRRC Submission

039660-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1623 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119733784-120138045 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120095704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 406 (S406P)

Ref Sequence

ENSEMBL: ENSMUSP00000130249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542] [ENSMUST00000226560]

AlphaFold

A2A884

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106307
AA Change: S406P

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: S406P

Domain	Start	End	E-Value	Type
ZnF_C2H2	185	207	1.67e-2	SMART
ZnF_C2H2	213	235	8.34e-3	SMART
low complexity region	257	285	N/A	INTRINSIC
low complexity region	292	323	N/A	INTRINSIC
low complexity region	425	438	N/A	INTRINSIC
low complexity region	513	527	N/A	INTRINSIC
low complexity region	589	612	N/A	INTRINSIC
low complexity region	622	633	N/A	INTRINSIC
ZnF_C2H2	636	656	2.06e1	SMART
low complexity region	736	749	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	844	865	N/A	INTRINSIC
low complexity region	878	894	N/A	INTRINSIC
low complexity region	896	931	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
low complexity region	1050	1061	N/A	INTRINSIC
low complexity region	1110	1136	N/A	INTRINSIC
low complexity region	1143	1167	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1259	1284	N/A	INTRINSIC
low complexity region	1376	1390	N/A	INTRINSIC
low complexity region	1529	1547	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
ZnF_C2H2	1720	1742	1.82e-3	SMART
ZnF_C2H2	1748	1772	1.69e-3	SMART
low complexity region	1778	1791	N/A	INTRINSIC
low complexity region	1814	1843	N/A	INTRINSIC
low complexity region	2203	2216	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166542
AA Change: S406P

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: S406P

Domain	Start	End	E-Value	Type
ZnF_C2H2	185	207	1.67e-2	SMART
ZnF_C2H2	213	235	8.34e-3	SMART
low complexity region	257	285	N/A	INTRINSIC
low complexity region	292	323	N/A	INTRINSIC
low complexity region	425	438	N/A	INTRINSIC
low complexity region	513	527	N/A	INTRINSIC
low complexity region	589	612	N/A	INTRINSIC
low complexity region	622	633	N/A	INTRINSIC
ZnF_C2H2	636	656	2.06e1	SMART
low complexity region	736	749	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	844	865	N/A	INTRINSIC
low complexity region	878	894	N/A	INTRINSIC
low complexity region	896	931	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
low complexity region	1050	1061	N/A	INTRINSIC
low complexity region	1110	1136	N/A	INTRINSIC
low complexity region	1143	1167	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1259	1284	N/A	INTRINSIC
low complexity region	1376	1390	N/A	INTRINSIC
low complexity region	1529	1547	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
ZnF_C2H2	1720	1742	1.82e-3	SMART
ZnF_C2H2	1748	1772	1.69e-3	SMART
low complexity region	1778	1791	N/A	INTRINSIC
low complexity region	1814	1843	N/A	INTRINSIC
low complexity region	2203	2216	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226560

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Actn2	A	T	13: 12,340,439	I21N	probably benign	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mical3	C	T	6: 121,024,807	V575M	probably damaging	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Olfr424	A	T	1: 174,137,317	D191V	probably damaging	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rad18	C	T	6: 112,628,519	S398N	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trdn	A	G	10: 33,258,102	K333R	possibly damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Hivep3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Hivep3	APN	4	120098374	missense	probably damaging	1.00
IGL01017:Hivep3	APN	4	120099246	missense	probably damaging	0.98
IGL01837:Hivep3	APN	4	120094562	missense	possibly damaging	0.72
IGL01878:Hivep3	APN	4	120095227	missense	possibly damaging	0.84
IGL02134:Hivep3	APN	4	120133574	splice site	probably benign
IGL02183:Hivep3	APN	4	120132024	missense	probably benign	0.04
IGL02350:Hivep3	APN	4	120123025	missense	probably damaging	1.00
IGL02451:Hivep3	APN	4	120133965	missense	probably damaging	1.00
IGL02567:Hivep3	APN	4	120133956	missense	probably damaging	0.99
IGL02617:Hivep3	APN	4	120095444	missense	probably benign	0.04
IGL02725:Hivep3	APN	4	120095822	missense	possibly damaging	0.48
IGL02828:Hivep3	APN	4	120097732	nonsense	probably null
IGL02954:Hivep3	APN	4	120133641	missense	probably damaging	1.00
IGL02966:Hivep3	APN	4	120132186	missense	probably benign	0.04
Branchial	UTSW	4	120096575	missense	possibly damaging	0.92
Deceit	UTSW	4	120097911	frame shift	probably null
Mandible	UTSW	4	120097121	missense	probably damaging	0.99
Sclerotic	UTSW	4	120095099	missense	possibly damaging	0.82
Stealth	UTSW	4	120122876	nonsense	probably null
Yellowjacket	UTSW	4	120132357	missense	probably benign	0.01
PIT4260001:Hivep3	UTSW	4	120099182	missense	probably damaging	1.00
R0321:Hivep3	UTSW	4	120095591	missense	possibly damaging	0.84
R0336:Hivep3	UTSW	4	120103847	missense	probably damaging	1.00
R0558:Hivep3	UTSW	4	120096566	missense	probably damaging	0.98
R0562:Hivep3	UTSW	4	120096554	missense	probably benign	0.00
R0637:Hivep3	UTSW	4	120132541	nonsense	probably null
R0645:Hivep3	UTSW	4	120097334	missense	possibly damaging	0.95
R1186:Hivep3	UTSW	4	119814723	start gained	probably benign
R1254:Hivep3	UTSW	4	120099293	missense	probably damaging	1.00
R1428:Hivep3	UTSW	4	120096575	missense	possibly damaging	0.92
R1739:Hivep3	UTSW	4	120095174	missense	probably benign	0.03
R1766:Hivep3	UTSW	4	120096671	missense	probably benign
R1769:Hivep3	UTSW	4	120097571	missense	possibly damaging	0.68
R1773:Hivep3	UTSW	4	120098837	missense	probably damaging	1.00
R1968:Hivep3	UTSW	4	120096238	missense	possibly damaging	0.83
R2220:Hivep3	UTSW	4	119734038	missense	possibly damaging	0.92
R2428:Hivep3	UTSW	4	120098508	nonsense	probably null
R3789:Hivep3	UTSW	4	120098416	missense	probably damaging	1.00
R3917:Hivep3	UTSW	4	120099427	missense	probably benign	0.27
R4366:Hivep3	UTSW	4	120096089	missense	possibly damaging	0.84
R4436:Hivep3	UTSW	4	120095923	missense	probably benign	0.11
R4504:Hivep3	UTSW	4	119733793	unclassified	probably benign
R4705:Hivep3	UTSW	4	119872050	intron	probably benign
R4713:Hivep3	UTSW	4	120131803	missense	probably damaging	1.00
R4756:Hivep3	UTSW	4	120097823	missense	probably damaging	0.98
R4887:Hivep3	UTSW	4	120122934	missense	probably damaging	1.00
R4888:Hivep3	UTSW	4	120122934	missense	probably damaging	1.00
R5008:Hivep3	UTSW	4	120098917	missense	probably benign	0.22
R5204:Hivep3	UTSW	4	120103856	critical splice donor site	probably null
R5594:Hivep3	UTSW	4	120123048	critical splice donor site	probably null
R5697:Hivep3	UTSW	4	120096955	missense	possibly damaging	0.68
R5715:Hivep3	UTSW	4	120096373	missense	probably benign
R5740:Hivep3	UTSW	4	120096023	missense	possibly damaging	0.83
R5760:Hivep3	UTSW	4	120095011	missense	possibly damaging	0.83
R5923:Hivep3	UTSW	4	120096293	missense	possibly damaging	0.92
R5927:Hivep3	UTSW	4	120097108	missense	possibly damaging	0.68
R6042:Hivep3	UTSW	4	120097864	missense	possibly damaging	0.85
R6074:Hivep3	UTSW	4	120097694	missense	possibly damaging	0.68
R6150:Hivep3	UTSW	4	119734077	nonsense	probably null
R6211:Hivep3	UTSW	4	120098405	missense	probably damaging	1.00
R6251:Hivep3	UTSW	4	120094940	missense	probably damaging	0.98
R6451:Hivep3	UTSW	4	120098908	missense	probably benign	0.22
R6531:Hivep3	UTSW	4	120122876	nonsense	probably null
R6651:Hivep3	UTSW	4	120122949	missense	probably damaging	1.00
R6701:Hivep3	UTSW	4	120094540	missense	probably damaging	0.97
R6721:Hivep3	UTSW	4	120095099	missense	possibly damaging	0.82
R6796:Hivep3	UTSW	4	120096361	missense	possibly damaging	0.68
R6864:Hivep3	UTSW	4	120094888	missense	possibly damaging	0.48
R6902:Hivep3	UTSW	4	120095995	missense	possibly damaging	0.48
R7111:Hivep3	UTSW	4	120095234	missense	possibly damaging	0.68
R7113:Hivep3	UTSW	4	120098369	missense	probably damaging	1.00
R7140:Hivep3	UTSW	4	120097121	missense	probably damaging	0.99
R7189:Hivep3	UTSW	4	120132219	missense	probably damaging	0.99
R7218:Hivep3	UTSW	4	120095452	missense	possibly damaging	0.92
R7366:Hivep3	UTSW	4	120097911	frame shift	probably null
R7368:Hivep3	UTSW	4	120097911	frame shift	probably null
R7491:Hivep3	UTSW	4	120098830	missense	probably benign	0.09
R7496:Hivep3	UTSW	4	120132402	missense	probably benign	0.00
R7514:Hivep3	UTSW	4	120096855	missense	possibly damaging	0.48
R7604:Hivep3	UTSW	4	120097911	frame shift	probably null
R7605:Hivep3	UTSW	4	120097911	frame shift	probably null
R7607:Hivep3	UTSW	4	120097911	frame shift	probably null
R7610:Hivep3	UTSW	4	120097911	frame shift	probably null
R7611:Hivep3	UTSW	4	120097911	frame shift	probably null
R7613:Hivep3	UTSW	4	120097911	frame shift	probably null
R7626:Hivep3	UTSW	4	120097911	frame shift	probably null
R7707:Hivep3	UTSW	4	119733959	missense
R7736:Hivep3	UTSW	4	120095543	missense	possibly damaging	0.92
R7915:Hivep3	UTSW	4	120097765	missense	possibly damaging	0.83
R7943:Hivep3	UTSW	4	120132357	missense	probably benign	0.01
R7972:Hivep3	UTSW	4	120097514	missense	possibly damaging	0.48
R8093:Hivep3	UTSW	4	120095435	missense	possibly damaging	0.68
R8111:Hivep3	UTSW	4	120098386	missense	probably damaging	0.99
R8215:Hivep3	UTSW	4	120122901	missense	probably damaging	1.00
R8364:Hivep3	UTSW	4	120099442	missense	probably benign	0.10
R8467:Hivep3	UTSW	4	120095041	missense	probably damaging	0.98
R8768:Hivep3	UTSW	4	120132324	missense	probably damaging	0.99
R8890:Hivep3	UTSW	4	120096460	missense	possibly damaging	0.95
R8902:Hivep3	UTSW	4	120096740	missense	possibly damaging	0.83
R9022:Hivep3	UTSW	4	120098107	missense	probably benign	0.09
R9336:Hivep3	UTSW	4	120095203	missense	possibly damaging	0.84
RF019:Hivep3	UTSW	4	120098270	missense	probably benign	0.12
X0062:Hivep3	UTSW	4	120098698	missense	probably damaging	1.00
X0067:Hivep3	UTSW	4	120131787	missense	probably damaging	0.96
Z1176:Hivep3	UTSW	4	120133782	missense	probably damaging	1.00
Z1177:Hivep3	UTSW	4	120095946	missense	possibly damaging	0.68
Z1177:Hivep3	UTSW	4	120131778	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAGAAGCCTCATCGGAACATC -3'
(R):5'- AGTGACTTCTCAGGAGAGGCACAG -3'

Sequencing Primer
(F):5'- TCATCGGAACATCCCCTGAG -3'
(R):5'- TGGGCTTCACACTGTCG -3'

Posted On

2014-04-24