Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Rad18'

174785

Institutional Source

Beutler Lab

Gene Symbol

Rad18

Ensembl Gene

ENSMUSG00000030254

Gene Name

RAD18 E3 ubiquitin protein ligase

Synonyms

2810024C04Rik

MMRRC Submission

039660-MU

Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1623 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

112619850-112696686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 112628519 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 398 (S398N)

Ref Sequence

ENSEMBL: ENSMUSP00000108807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000142079]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068487
AA Change: S505N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: S505N

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
internal_repeat_1	398	422	2.94e-14	PROSPERO
internal_repeat_1	422	446	2.94e-14	PROSPERO
low complexity region	473	488	N/A	INTRINSIC
low complexity region	495	507	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077088

SMART Domains

Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
PDB:2YBF\|B	340	363	7e-6	PDB
internal_repeat_1	372	396	1.24e-14	PROSPERO
internal_repeat_1	396	420	1.24e-14	PROSPERO
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113180

SMART Domains

Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
low complexity region	366	381	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113182
AA Change: S398N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: S398N

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
low complexity region	366	381	N/A	INTRINSIC
low complexity region	388	400	N/A	INTRINSIC
low complexity region	407	415	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132590

Predicted Effect

probably benign
Transcript: ENSMUST00000142079

SMART Domains

Protein: ENSMUSP00000117582
Gene: ENSMUSG00000030254

Domain	Start	End	E-Value	Type
internal_repeat_1	112	136	3.29e-13	PROSPERO
internal_repeat_1	136	160	3.29e-13	PROSPERO
low complexity region	187	202	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Actn2	A	T	13: 12,340,439	I21N	probably benign	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hivep3	T	C	4: 120,095,704	S406P	possibly damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mical3	C	T	6: 121,024,807	V575M	probably damaging	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Olfr424	A	T	1: 174,137,317	D191V	probably damaging	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trdn	A	G	10: 33,258,102	K333R	possibly damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Rad18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01577:Rad18	APN	6	112665341	splice site	probably benign
IGL02425:Rad18	APN	6	112620898	missense	probably damaging	1.00
IGL02622:Rad18	APN	6	112687987	missense	probably damaging	0.99
IGL02814:Rad18	APN	6	112644622	missense	possibly damaging	0.72
3-1:Rad18	UTSW	6	112681511	nonsense	probably null
R0823:Rad18	UTSW	6	112665299	missense	possibly damaging	0.80
R1220:Rad18	UTSW	6	112649664	nonsense	probably null
R1351:Rad18	UTSW	6	112620902	missense	possibly damaging	0.55
R1378:Rad18	UTSW	6	112681336	splice site	probably benign
R1737:Rad18	UTSW	6	112681537	missense	probably damaging	1.00
R2509:Rad18	UTSW	6	112675922	missense	possibly damaging	0.93
R2893:Rad18	UTSW	6	112675773	nonsense	probably null
R2894:Rad18	UTSW	6	112675773	nonsense	probably null
R3017:Rad18	UTSW	6	112681366	missense	possibly damaging	0.95
R3123:Rad18	UTSW	6	112681346	missense	probably benign	0.41
R3755:Rad18	UTSW	6	112693471	missense	probably damaging	1.00
R4392:Rad18	UTSW	6	112693529	missense	probably damaging	1.00
R5285:Rad18	UTSW	6	112686765	missense	probably benign	0.45
R5566:Rad18	UTSW	6	112681346	missense	probably benign	0.41
R5958:Rad18	UTSW	6	112696642	unclassified	probably benign
R6744:Rad18	UTSW	6	112675784	missense	probably damaging	1.00
R7072:Rad18	UTSW	6	112681440	missense	probably benign	0.01
R7247:Rad18	UTSW	6	112665325	missense	possibly damaging	0.81
R7860:Rad18	UTSW	6	112649837	missense	probably benign	0.01
R8223:Rad18	UTSW	6	112688021	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGACTCCAGTTCCACAGTGAGAAAG -3'
(R):5'- GGAATGTGGCTGTGCAACTATCCTC -3'

Sequencing Primer
(F):5'- AGAGCCTTCCACCTGGATTG -3'
(R):5'- AACTATCCTCACAGTGTGCATGG -3'

Posted On

2014-04-24