Incidental Mutation 'R1623:Rad18'
ID174785
Institutional Source Beutler Lab
Gene Symbol Rad18
Ensembl Gene ENSMUSG00000030254
Gene NameRAD18 E3 ubiquitin protein ligase
Synonyms2810024C04Rik
MMRRC Submission 039660-MU
Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1623 (G1)
Quality Score207
Status Not validated
Chromosome6
Chromosomal Location112619850-112696686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112628519 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 398 (S398N)
Ref Sequence ENSEMBL: ENSMUSP00000108807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000142079]
Predicted Effect probably damaging
Transcript: ENSMUST00000068487
AA Change: S505N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: S505N

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
internal_repeat_1 398 422 2.94e-14 PROSPERO
internal_repeat_1 422 446 2.94e-14 PROSPERO
low complexity region 473 488 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077088
SMART Domains Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
PDB:2YBF|B 340 363 7e-6 PDB
internal_repeat_1 372 396 1.24e-14 PROSPERO
internal_repeat_1 396 420 1.24e-14 PROSPERO
low complexity region 447 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113180
SMART Domains Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113182
AA Change: S398N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: S398N

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
low complexity region 388 400 N/A INTRINSIC
low complexity region 407 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132590
Predicted Effect probably benign
Transcript: ENSMUST00000142079
SMART Domains Protein: ENSMUSP00000117582
Gene: ENSMUSG00000030254

DomainStartEndE-ValueType
internal_repeat_1 112 136 3.29e-13 PROSPERO
internal_repeat_1 136 160 3.29e-13 PROSPERO
low complexity region 187 202 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI

 All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Rad18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Rad18 APN 6 112665341 splice site probably benign
IGL02425:Rad18 APN 6 112620898 missense probably damaging 1.00
IGL02622:Rad18 APN 6 112687987 missense probably damaging 0.99
IGL02814:Rad18 APN 6 112644622 missense possibly damaging 0.72
3-1:Rad18 UTSW 6 112681511 nonsense probably null
R0823:Rad18 UTSW 6 112665299 missense possibly damaging 0.80
R1220:Rad18 UTSW 6 112649664 nonsense probably null
R1351:Rad18 UTSW 6 112620902 missense possibly damaging 0.55
R1378:Rad18 UTSW 6 112681336 splice site probably benign
R1737:Rad18 UTSW 6 112681537 missense probably damaging 1.00
R2509:Rad18 UTSW 6 112675922 missense possibly damaging 0.93
R2893:Rad18 UTSW 6 112675773 nonsense probably null
R2894:Rad18 UTSW 6 112675773 nonsense probably null
R3017:Rad18 UTSW 6 112681366 missense possibly damaging 0.95
R3123:Rad18 UTSW 6 112681346 missense probably benign 0.41
R3755:Rad18 UTSW 6 112693471 missense probably damaging 1.00
R4392:Rad18 UTSW 6 112693529 missense probably damaging 1.00
R5285:Rad18 UTSW 6 112686765 missense probably benign 0.45
R5566:Rad18 UTSW 6 112681346 missense probably benign 0.41
R5958:Rad18 UTSW 6 112696642 unclassified probably benign
R6744:Rad18 UTSW 6 112675784 missense probably damaging 1.00
R7072:Rad18 UTSW 6 112681440 missense probably benign 0.01
R7247:Rad18 UTSW 6 112665325 missense possibly damaging 0.81
R7860:Rad18 UTSW 6 112649837 missense probably benign 0.01
R8223:Rad18 UTSW 6 112688021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACTCCAGTTCCACAGTGAGAAAG -3'
(R):5'- GGAATGTGGCTGTGCAACTATCCTC -3'

Sequencing Primer
(F):5'- AGAGCCTTCCACCTGGATTG -3'
(R):5'- AACTATCCTCACAGTGTGCATGG -3'
Posted On2014-04-24