Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Mical3'

174786

Institutional Source

Beutler Lab

Gene Symbol

Mical3

Ensembl Gene

ENSMUSG00000051586

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 3

Synonyms

MICAL-3, C130040D16Rik

MMRRC Submission

039660-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R1623 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

120931707-121130999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121024807 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 575 (V575M)

Ref Sequence

ENSEMBL: ENSMUSP00000146544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204248] [ENSMUST00000204302] [ENSMUST00000205030] [ENSMUST00000207889]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077159
AA Change: V575M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: V575M

Domain	Start	End	E-Value	Type
low complexity region	60	69	N/A	INTRINSIC
Pfam:FAD_binding_3	86	142	1.4e-7	PFAM
low complexity region	162	175	N/A	INTRINSIC
CH	520	619	4.44e-17	SMART
low complexity region	625	635	N/A	INTRINSIC
LIM	763	815	2.78e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203188

Predicted Effect

probably benign
Transcript: ENSMUST00000203254
AA Change: V575M

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586
AA Change: V575M

Domain	Start	End	E-Value	Type
low complexity region	60	69	N/A	INTRINSIC
Pfam:FAD_binding_3	86	142	8.6e-6	PFAM
low complexity region	162	175	N/A	INTRINSIC
CH	520	619	2.2e-19	SMART
low complexity region	640	655	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204248
AA Change: V575M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000145439
Gene: ENSMUSG00000051586
AA Change: V575M

Domain	Start	End	E-Value	Type
low complexity region	60	69	N/A	INTRINSIC
Pfam:FAD_binding_3	86	142	9.1e-6	PFAM
low complexity region	162	175	N/A	INTRINSIC
CH	520	619	2.2e-19	SMART
low complexity region	625	635	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204302

SMART Domains

Protein: ENSMUSP00000144972
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
LIM	82	136	5.39e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204644

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205020

Predicted Effect

probably benign
Transcript: ENSMUST00000205030

SMART Domains

Protein: ENSMUSP00000144882
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
LIM	115	167	1.4e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207889
AA Change: V575M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

unknown
Transcript: ENSMUST00000212208
AA Change: V10M

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Actn2	A	T	13: 12,340,439	I21N	probably benign	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hivep3	T	C	4: 120,095,704	S406P	possibly damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Olfr424	A	T	1: 174,137,317	D191V	probably damaging	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rad18	C	T	6: 112,628,519	S398N	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trdn	A	G	10: 33,258,102	K333R	possibly damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Mical3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Mical3	APN	6	120961624	missense	possibly damaging	0.73
IGL00718:Mical3	APN	6	121040449	missense	probably damaging	0.98
IGL00940:Mical3	APN	6	121022410	missense	possibly damaging	0.55
IGL00973:Mical3	APN	6	120934924	splice site	probably benign
IGL01503:Mical3	APN	6	120958576	missense	probably benign	0.09
IGL01991:Mical3	APN	6	120935211	missense	probably damaging	0.98
IGL02794:Mical3	APN	6	121007309	missense	probably damaging	0.99
IGL02996:Mical3	APN	6	120958558	missense	probably damaging	1.00
IGL03105:Mical3	APN	6	121042238	missense	probably benign	0.01
IGL03109:Mical3	APN	6	121009124	missense	probably damaging	1.00
IGL03236:Mical3	APN	6	120969384	missense	probably benign	0.00
P0028:Mical3	UTSW	6	121024689	missense	probably benign	0.33
R0244:Mical3	UTSW	6	120957722	missense	probably benign	0.00
R0494:Mical3	UTSW	6	120959201	missense	possibly damaging	0.94
R0586:Mical3	UTSW	6	121029641	unclassified	probably benign
R1029:Mical3	UTSW	6	120934678	missense	probably benign	0.02
R1263:Mical3	UTSW	6	120952469	missense	probably damaging	0.99
R1507:Mical3	UTSW	6	121042238	missense	probably benign	0.36
R1527:Mical3	UTSW	6	121024779	missense	probably damaging	0.99
R1680:Mical3	UTSW	6	120959643	missense	probably benign	0.09
R1697:Mical3	UTSW	6	121007408	missense	possibly damaging	0.84
R1817:Mical3	UTSW	6	121042235	missense	probably benign	0.06
R1875:Mical3	UTSW	6	121042064	missense	probably damaging	1.00
R1961:Mical3	UTSW	6	120982607	missense	possibly damaging	0.94
R2004:Mical3	UTSW	6	120951322	missense	probably damaging	1.00
R2093:Mical3	UTSW	6	121040386	missense	probably damaging	1.00
R2141:Mical3	UTSW	6	121031134	splice site	probably null
R2142:Mical3	UTSW	6	121031134	splice site	probably null
R2257:Mical3	UTSW	6	121033735	missense	possibly damaging	0.94
R2404:Mical3	UTSW	6	120959828	missense	probably benign	0.01
R2419:Mical3	UTSW	6	120959923	missense	probably benign
R2509:Mical3	UTSW	6	121034157	missense	probably damaging	1.00
R3784:Mical3	UTSW	6	121021337	missense	probably benign	0.00
R4342:Mical3	UTSW	6	120934838	nonsense	probably null
R4343:Mical3	UTSW	6	120934838	nonsense	probably null
R4579:Mical3	UTSW	6	120958699	missense	probably benign
R4603:Mical3	UTSW	6	120934838	nonsense	probably null
R4605:Mical3	UTSW	6	121034080	nonsense	probably null
R4610:Mical3	UTSW	6	120934838	nonsense	probably null
R4611:Mical3	UTSW	6	120934838	nonsense	probably null
R4623:Mical3	UTSW	6	120961625	nonsense	probably null
R4669:Mical3	UTSW	6	120957703	missense	probably damaging	0.98
R4704:Mical3	UTSW	6	120958688	missense	probably benign	0.00
R4722:Mical3	UTSW	6	121038525	missense	probably benign	0.00
R4863:Mical3	UTSW	6	121033787	missense	probably damaging	0.99
R4878:Mical3	UTSW	6	120969387	missense	possibly damaging	0.51
R4885:Mical3	UTSW	6	120935253	missense	probably damaging	1.00
R4907:Mical3	UTSW	6	121007298	missense	probably benign	0.00
R5007:Mical3	UTSW	6	121038069	missense	probably damaging	0.98
R5299:Mical3	UTSW	6	120959512	missense	possibly damaging	0.71
R5303:Mical3	UTSW	6	120959980	missense	probably benign
R5368:Mical3	UTSW	6	120959473	missense	probably damaging	1.00
R5955:Mical3	UTSW	6	121033750	missense	probably damaging	0.99
R5970:Mical3	UTSW	6	120958271	nonsense	probably null
R6000:Mical3	UTSW	6	121021320	missense	probably benign	0.06
R6101:Mical3	UTSW	6	121033710	missense	probably damaging	1.00
R6195:Mical3	UTSW	6	121016835	intron	probably benign
R6210:Mical3	UTSW	6	121040517	splice site	probably null
R6225:Mical3	UTSW	6	120958723	missense	probably damaging	0.98
R6258:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6260:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6349:Mical3	UTSW	6	120959525	missense	probably benign
R6352:Mical3	UTSW	6	120952473	missense	probably damaging	0.97
R6480:Mical3	UTSW	6	121034275	missense	possibly damaging	0.76
R6704:Mical3	UTSW	6	121009800	intron	probably benign
R6783:Mical3	UTSW	6	120958825	missense	possibly damaging	0.85
R6925:Mical3	UTSW	6	120959390	missense	probably benign	0.05
R6960:Mical3	UTSW	6	120958543	missense	probably damaging	1.00
R7170:Mical3	UTSW	6	120973733	splice site	probably null
R7344:Mical3	UTSW	6	121036544	nonsense	probably null
R7414:Mical3	UTSW	6	121034113	missense	probably damaging	1.00
R7455:Mical3	UTSW	6	120958744	missense	probably damaging	1.00
R7649:Mical3	UTSW	6	120934948	missense	probably damaging	1.00
R8236:Mical3	UTSW	6	121012543	missense
R8286:Mical3	UTSW	6	121021188	missense	possibly damaging	0.68
R8316:Mical3	UTSW	6	120934983	missense	probably damaging	1.00
R8328:Mical3	UTSW	6	120935177	missense	probably damaging	0.98
R8354:Mical3	UTSW	6	120973420	missense	probably damaging	0.99
R8511:Mical3	UTSW	6	121038552	missense	possibly damaging	0.78
U24488:Mical3	UTSW	6	121001496	missense	possibly damaging	0.90
Z1177:Mical3	UTSW	6	120959728	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GAGCGAGTCCTTGAACATCTCGTAG -3'
(R):5'- GTAAGAAGTTGGTGTCCCCGGAAG -3'

Sequencing Primer
(F):5'- GTCCTTGAACATCTCGTAGAACTG -3'
(R):5'- CGAGGGAGACCTATAGTCATTTC -3'

Posted On

2014-04-24