Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Trdn'

174799

Institutional Source

Beutler Lab

Gene Symbol

Trdn

Ensembl Gene

ENSMUSG00000019787

Gene Name

triadin

Synonyms

triadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3

MMRRC Submission

039660-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R1623 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33080554-33476709 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33258102 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 333 (K333R)

Ref Sequence

ENSEMBL: ENSMUSP00000093436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095762]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095762
AA Change: K333R

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: K333R

Domain	Start	End	E-Value	Type
SCOP:d1lnqa2	49	116	1e-4	SMART
low complexity region	147	158	N/A	INTRINSIC
low complexity region	166	182	N/A	INTRINSIC
low complexity region	198	223	N/A	INTRINSIC
low complexity region	229	250	N/A	INTRINSIC
coiled coil region	306	333	N/A	INTRINSIC
low complexity region	342	352	N/A	INTRINSIC
low complexity region	380	396	N/A	INTRINSIC
coiled coil region	417	437	N/A	INTRINSIC
low complexity region	448	484	N/A	INTRINSIC
low complexity region	539	551	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217716

Predicted Effect

unknown
Transcript: ENSMUST00000219211
AA Change: K137R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219691

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Actn2	A	T	13: 12,340,439	I21N	probably benign	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hivep3	T	C	4: 120,095,704	S406P	possibly damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mical3	C	T	6: 121,024,807	V575M	probably damaging	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Olfr424	A	T	1: 174,137,317	D191V	probably damaging	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rad18	C	T	6: 112,628,519	S398N	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Trdn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Trdn	APN	10	33471606	critical splice donor site	probably null
IGL01310:Trdn	APN	10	33305098	splice site	probably benign
IGL01313:Trdn	APN	10	33200220	missense	probably damaging	1.00
IGL02177:Trdn	APN	10	33139173	missense	probably damaging	1.00
IGL02631:Trdn	APN	10	33363976	critical splice acceptor site	probably null
IGL02732:Trdn	APN	10	33468199	splice site	probably null
IGL03131:Trdn	APN	10	33398414	nonsense	probably null
Button	UTSW	10	33474453	missense	probably damaging	0.97
R0463:Trdn	UTSW	10	33466421	critical splice acceptor site	probably null
R0610:Trdn	UTSW	10	33474453	missense	probably damaging	0.97
R0786:Trdn	UTSW	10	33305081	missense	probably benign	0.22
R0827:Trdn	UTSW	10	33399158	splice site	probably benign
R1511:Trdn	UTSW	10	33466452	missense	probably benign	0.18
R1760:Trdn	UTSW	10	33233887	missense	possibly damaging	0.92
R1766:Trdn	UTSW	10	33364008	missense	probably damaging	1.00
R1884:Trdn	UTSW	10	33257095	missense	probably benign	0.38
R2297:Trdn	UTSW	10	33335012	missense	probably damaging	1.00
R2396:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R3436:Trdn	UTSW	10	33468195	critical splice donor site	probably null
R3686:Trdn	UTSW	10	33468189	missense	probably benign	0.20
R3696:Trdn	UTSW	10	33305032	splice site	probably null
R3701:Trdn	UTSW	10	33334984	missense	probably damaging	0.99
R3712:Trdn	UTSW	10	33157166	missense	probably benign	0.03
R4062:Trdn	UTSW	10	33257087	missense	probably benign	0.05
R4249:Trdn	UTSW	10	33450998	missense	probably benign	0.09
R4289:Trdn	UTSW	10	33464582	missense	probably benign	0.00
R4646:Trdn	UTSW	10	33195981	nonsense	probably null
R4647:Trdn	UTSW	10	33195981	nonsense	probably null
R4648:Trdn	UTSW	10	33195981	nonsense	probably null
R4766:Trdn	UTSW	10	33474506	missense	probably benign	0.04
R4776:Trdn	UTSW	10	33399082	splice site	probably null
R4880:Trdn	UTSW	10	33471579	missense	probably benign	0.26
R4898:Trdn	UTSW	10	33474417	missense	probably damaging	0.96
R5017:Trdn	UTSW	10	33468159	missense	probably benign	0.05
R5300:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R5320:Trdn	UTSW	10	33333251	critical splice donor site	probably null
R6089:Trdn	UTSW	10	33464575	missense	probably benign	0.01
R6216:Trdn	UTSW	10	33305069	missense	probably damaging	1.00
R6431:Trdn	UTSW	10	33139114	missense	probably damaging	1.00
R6475:Trdn	UTSW	10	33464555	splice site	probably null
R6501:Trdn	UTSW	10	33466454	missense	probably benign	0.02
R6662:Trdn	UTSW	10	33474487	missense	probably damaging	0.98
R6709:Trdn	UTSW	10	33464591	missense	probably benign	0.00
R6783:Trdn	UTSW	10	33438815	missense	probably damaging	0.96
R6906:Trdn	UTSW	10	33233948	missense	probably benign
R6916:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R7291:Trdn	UTSW	10	33437736	missense	probably null	0.83
R7499:Trdn	UTSW	10	33196101	missense	probably benign
R7601:Trdn	UTSW	10	33196156	missense	probably benign	0.00
R7743:Trdn	UTSW	10	33257062	nonsense	probably null
R8114:Trdn	UTSW	10	33083628	start gained	probably benign
R8220:Trdn	UTSW	10	33450985	missense	possibly damaging	0.57
R8228:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R8329:Trdn	UTSW	10	33444078	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGTGACAAGTCATCTGGCATCTTA -3'
(R):5'- CCACACTTCTGTTTTGACATGCTACAC -3'

Sequencing Primer
(F):5'- ACAGGAATCCTAAGCTTTCGGTG -3'
(R):5'- GCTACACATGGATAGATGTGAATACC -3'

Posted On

2014-04-24