Incidental Mutation 'R1623:Ctc1'
ID174808
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69021142 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 49 (T49M)
Ref Sequence ENSEMBL: ENSMUSP00000125028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021278
AA Change: T49M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898
AA Change: T49M

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116359
AA Change: T49M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898
AA Change: T49M

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146621
Predicted Effect probably damaging
Transcript: ENSMUST00000152979
AA Change: T49M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000161455
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1876:Ctc1 UTSW 11 69031564 missense probably benign 0.24
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2164:Ctc1 UTSW 11 69035615 missense possibly damaging 0.92
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3966:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4605:Ctc1 UTSW 11 69029726 missense possibly damaging 0.86
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
R7204:Ctc1 UTSW 11 69029741 missense probably damaging 1.00
R7252:Ctc1 UTSW 11 69026174 missense probably damaging 1.00
R7357:Ctc1 UTSW 11 69034742 missense probably benign 0.17
R7654:Ctc1 UTSW 11 69026215 missense probably damaging 1.00
R7724:Ctc1 UTSW 11 69026344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGGGCAGGATATTGTGAAACTG -3'
(R):5'- TGCACACGTCACATCAGCTCAA -3'

Sequencing Primer
(F):5'- GCAGGATATTGTGAAACTGTTTTAAC -3'
(R):5'- GTCACATCAGCTCAATCACTGTC -3'
Posted On2014-04-24