Mutagenetix > Incidental Mutations

Incidental Mutation 'R1623:Actn2'

174818

Institutional Source

Beutler Lab

Gene Symbol

Actn2

Ensembl Gene

ENSMUSG00000052374

Gene Name

actinin alpha 2

Synonyms

MMRRC Submission

039660-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.642) question?

Stock #

R1623 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

12269426-12340760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12340439 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 21 (I21N)

Ref Sequence

ENSEMBL: ENSMUSP00000129609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]

Predicted Effect

probably benign
Transcript: ENSMUST00000064204
AA Change: I21N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: I21N

Domain	Start	End	E-Value	Type
CH	40	140	5.22e-23	SMART
CH	153	252	1.77e-25	SMART
low complexity region	255	266	N/A	INTRINSIC
Pfam:Spectrin	281	391	2e-16	PFAM
SPEC	404	505	5.81e-24	SMART
SPEC	519	626	6.75e-11	SMART
SPEC	640	739	1.26e0	SMART
EFh	757	785	8.16e-1	SMART
EFh	793	821	7.7e-3	SMART
efhand_Ca_insen	824	890	3.9e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110616

SMART Domains

Protein: ENSMUSP00000106246
Gene: ENSMUSG00000052374

Domain	Start	End	E-Value	Type
CH	40	140	5.22e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168193
AA Change: I21N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: I21N

Domain	Start	End	E-Value	Type
CH	40	140	5.22e-23	SMART
CH	153	252	1.77e-25	SMART
low complexity region	255	266	N/A	INTRINSIC
Pfam:Spectrin	281	391	7e-18	PFAM
SPEC	404	505	5.81e-24	SMART
SPEC	519	626	6.75e-11	SMART
SPEC	640	739	1.26e0	SMART
EFh	757	785	8.16e-1	SMART
EFh	793	821	7.7e-3	SMART
efhand_Ca_insen	824	890	3.9e-37	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 94.9%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	G	A	17: 25,947,534	P343L	probably benign	Het
Acbd5	A	T	2: 23,094,344	D294V	probably damaging	Het
Adamts2	C	A	11: 50,668,115	P219H	possibly damaging	Het
Atg16l2	A	G	7: 101,289,906	F584L	probably benign	Het
Ccdc81	C	T	7: 89,886,182	R282Q	probably benign	Het
Cd200r3	G	A	16: 44,951,448	C25Y	possibly damaging	Het
Cdkl4	C	T	17: 80,556,302		probably null	Het
Chrne	T	C	11: 70,618,428	E109G	possibly damaging	Het
Clmp	A	G	9: 40,782,560	T358A	probably benign	Het
Cmtr1	G	T	17: 29,687,047		probably null	Het
Col25a1	A	G	3: 130,550,050	E389G	probably damaging	Het
Ctc1	C	T	11: 69,021,142	T49M	probably damaging	Het
Cyth3	T	A	5: 143,701,372	M120K	probably damaging	Het
D430041D05Rik	T	A	2: 104,152,963	E1996V	probably damaging	Het
Dnah9	T	C	11: 66,037,637	M2069V	probably damaging	Het
Dsg1c	T	C	18: 20,275,177	Y428H	probably damaging	Het
Exosc8	T	A	3: 54,734,331	T7S	probably damaging	Het
F5	A	G	1: 164,195,622	Y1583C	probably damaging	Het
Fam178b	A	G	1: 36,644,324	I105T	probably damaging	Het
Fam181a	T	A	12: 103,316,332	Y165*	probably null	Het
Fam212b	G	A	3: 105,716,820	G151D	probably damaging	Het
Fbn2	G	T	18: 58,048,548	N1880K	possibly damaging	Het
Gbgt1	A	T	2: 28,504,976	M209L	probably benign	Het
Gkn2	C	A	6: 87,378,170	Y120*	probably null	Het
Gm14295	T	A	2: 176,807,364	D1E	probably damaging	Het
Gpr141	A	T	13: 19,751,912		probably null	Het
Gramd3	C	A	18: 56,432,351	P26Q	probably benign	Het
Greb1	A	G	12: 16,674,770	I1801T	probably damaging	Het
Gstm3	T	A	3: 107,967,835	I64F	possibly damaging	Het
Gtse1	A	G	15: 85,867,578	Y324C	probably benign	Het
Hal	C	G	10: 93,516,297	T650R	probably benign	Het
Hdac7	G	A	15: 97,808,404	Q293*	probably null	Het
Hdlbp	A	T	1: 93,423,869	N437K	probably damaging	Het
Hif1an	A	G	19: 44,569,423	D248G	probably damaging	Het
Hivep3	T	C	4: 120,095,704	S406P	possibly damaging	Het
Hmcn2	A	T	2: 31,458,039	D4899V	possibly damaging	Het
Ikzf3	C	T	11: 98,490,331		probably null	Het
Itgb4	C	A	11: 115,991,316	Y819*	probably null	Het
Itpripl1	T	C	2: 127,141,635	D189G	possibly damaging	Het
Kmt2e	A	G	5: 23,482,502	Y450C	probably damaging	Het
Mc4r	A	G	18: 66,859,997	L15P	probably benign	Het
Mical1	T	G	10: 41,481,393		probably null	Het
Mical3	C	T	6: 121,024,807	V575M	probably damaging	Het
Mki67	A	T	7: 135,708,818		probably null	Het
Mocs2	G	A	13: 114,824,622	E52K	probably benign	Het
Myo7b	T	C	18: 32,000,051	N415S	probably damaging	Het
Notch1	G	A	2: 26,478,612	T555I	possibly damaging	Het
Notch3	T	C	17: 32,139,191	D1686G	probably benign	Het
Oit3	A	G	10: 59,428,239	F358L	probably damaging	Het
Olfr417	A	C	1: 174,368,949	I11L	probably benign	Het
Olfr424	A	T	1: 174,137,317	D191V	probably damaging	Het
Orai1	T	A	5: 123,029,202	I146N	probably damaging	Het
Pck1	A	G	2: 173,154,718	I142V	probably benign	Het
Pdap1	C	T	5: 145,132,929	V89M	possibly damaging	Het
Phf11a	T	C	14: 59,287,551	D68G	possibly damaging	Het
Pilrb2	T	C	5: 137,871,248	N30S	probably damaging	Het
Pkd1	G	A	17: 24,578,269	V2551I	probably damaging	Het
Pnpla7	T	C	2: 25,052,599	V132A	probably damaging	Het
Rad18	C	T	6: 112,628,519	S398N	probably damaging	Het
Rdh16f1	C	A	10: 127,790,853	N258K	probably benign	Het
Riox2	A	G	16: 59,483,042	H240R	probably damaging	Het
Ruvbl1	C	T	6: 88,485,770	A292V	probably damaging	Het
Ryr1	C	T	7: 29,095,490	G1151S	probably damaging	Het
Serpinb9b	T	C	13: 33,029,565	I35T	possibly damaging	Het
Slc1a1	T	A	19: 28,904,722	M328K	probably benign	Het
Slc7a13	A	T	4: 19,824,031	T267S	possibly damaging	Het
Speer3	G	T	5: 13,796,321	M218I	probably benign	Het
Sptan1	A	G	2: 29,986,420	I271V	probably damaging	Het
Swap70	A	G	7: 110,264,048	T195A	probably benign	Het
Tgs1	T	A	4: 3,585,964	N280K	probably benign	Het
Tonsl	A	G	15: 76,638,509	C181R	probably damaging	Het
Trdn	A	G	10: 33,258,102	K333R	possibly damaging	Het
Trpc4	T	A	3: 54,299,179	M600K	probably damaging	Het
Ubr3	C	T	2: 69,977,723	Q1183*	probably null	Het
Ubxn4	T	A	1: 128,272,851	L360I	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,408	T31S	probably benign	Het
Uspl1	T	C	5: 149,215,199	S1056P	probably damaging	Het
Vmn2r60	A	T	7: 42,135,855	K164*	probably null	Het
Vwce	T	A	19: 10,646,744	L333*	probably null	Het
Wdr95	T	A	5: 149,574,116	L253Q	probably damaging	Het
Wisp1	G	T	15: 66,891,599	V12L	possibly damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp142	T	C	1: 74,571,775	T851A	possibly damaging	Het

Other mutations in Actn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Actn2	APN	13	12310910	missense	possibly damaging	0.50
IGL01909:Actn2	APN	13	12309593	critical splice donor site	probably null
IGL01994:Actn2	APN	13	12290677	missense	probably benign	0.26
IGL02118:Actn2	APN	13	12276547	intron	probably benign
IGL02480:Actn2	APN	13	12276478	missense	probably benign	0.02
IGL02827:Actn2	APN	13	12275199	missense	probably damaging	1.00
IGL03110:Actn2	APN	13	12309607	missense	probably benign	0.02
R0044:Actn2	UTSW	13	12275127	missense	possibly damaging	0.51
R0512:Actn2	UTSW	13	12277415	missense	probably damaging	1.00
R1983:Actn2	UTSW	13	12278810	missense	probably benign	0.00
R1989:Actn2	UTSW	13	12340395	missense	probably benign	0.38
R2148:Actn2	UTSW	13	12300949	missense	probably damaging	0.99
R2196:Actn2	UTSW	13	12275179	missense	probably damaging	0.99
R2254:Actn2	UTSW	13	12296479	missense	probably benign	0.20
R2850:Actn2	UTSW	13	12275179	missense	probably damaging	0.99
R4391:Actn2	UTSW	13	12290748	missense	probably damaging	0.99
R4396:Actn2	UTSW	13	12310879	missense	probably damaging	1.00
R4758:Actn2	UTSW	13	12288586	nonsense	probably null
R5068:Actn2	UTSW	13	12288522	missense	possibly damaging	0.78
R5069:Actn2	UTSW	13	12288522	missense	possibly damaging	0.78
R5070:Actn2	UTSW	13	12288522	missense	possibly damaging	0.78
R5228:Actn2	UTSW	13	12288659	critical splice acceptor site	probably null
R5382:Actn2	UTSW	13	12308951	missense	probably benign	0.37
R5408:Actn2	UTSW	13	12270795	missense	probably benign	0.41
R5975:Actn2	UTSW	13	12340497	missense	probably benign	0.43
R6189:Actn2	UTSW	13	12276440	missense	probably damaging	1.00
R6226:Actn2	UTSW	13	12278967	missense	probably benign
R6498:Actn2	UTSW	13	12276473	missense	probably damaging	1.00
R7094:Actn2	UTSW	13	12309657	missense	probably damaging	1.00
R7164:Actn2	UTSW	13	12278961	missense	probably damaging	1.00
R7218:Actn2	UTSW	13	12278913	missense	probably benign	0.33
R7260:Actn2	UTSW	13	12276490	missense	probably benign	0.00
R7768:Actn2	UTSW	13	12282594	missense	possibly damaging	0.72
R7896:Actn2	UTSW	13	12294317	missense	possibly damaging	0.76
R8141:Actn2	UTSW	13	12288630	missense	probably damaging	1.00
X0018:Actn2	UTSW	13	12269645	missense	probably damaging	1.00
Z1177:Actn2	UTSW	13	12288562	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACAGCAGGGTCTGTCACAAAATAAC -3'
(R):5'- CGTGACTCTCAGCGGGCTATTAATC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- ccatccatccatccatccattc -3'

Posted On

2014-04-24