Incidental Mutation 'R1623:Myo7b'
ID 174836
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1623 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 31959234-32036961 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32000051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 415 (N415S)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: N415S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: N415S

MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
R8984:Myo7b UTSW 18 31966349 missense probably null 0.68
R9356:Myo7b UTSW 18 31977043 missense probably damaging 1.00
R9357:Myo7b UTSW 18 31960076 missense probably damaging 1.00
R9364:Myo7b UTSW 18 32000360 missense probably benign 0.12
R9405:Myo7b UTSW 18 31976303 missense probably benign 0.00
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccactgtttttacttcccc -3'
Posted On 2014-04-24