Incidental Mutation 'R1623:Gramd3'
ID174838
Institutional Source Beutler Lab
Gene Symbol Gramd3
Ensembl Gene ENSMUSG00000001700
Gene NameGRAM domain containing 3
Synonyms
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1623 (G1)
Quality Score208
Status Not validated
Chromosome18
Chromosomal Location56432132-56503792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56432351 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 26 (P26Q)
Ref Sequence ENSEMBL: ENSMUSP00000068453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070166]
Predicted Effect probably benign
Transcript: ENSMUST00000070166
AA Change: P26Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068453
Gene: ENSMUSG00000001700
AA Change: P26Q

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
GRAM 110 177 3.06e-23 SMART
transmembrane domain 342 364 N/A INTRINSIC
coiled coil region 404 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Gramd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Gramd3 APN 18 56485416 missense probably damaging 0.99
IGL01903:Gramd3 APN 18 56474029 missense probably damaging 0.99
IGL02203:Gramd3 APN 18 56478954 critical splice donor site probably null
IGL03210:Gramd3 APN 18 56474098 missense probably benign
PIT4283001:Gramd3 UTSW 18 56489663 missense probably damaging 1.00
R0432:Gramd3 UTSW 18 56474069 missense probably benign 0.00
R4019:Gramd3 UTSW 18 56478954 critical splice donor site probably null
R4125:Gramd3 UTSW 18 56485224 missense probably damaging 1.00
R4750:Gramd3 UTSW 18 56432300 missense probably benign 0.44
R4927:Gramd3 UTSW 18 56485451 missense probably damaging 0.96
R5495:Gramd3 UTSW 18 56482622 missense probably damaging 1.00
R5866:Gramd3 UTSW 18 56474036 missense possibly damaging 0.93
R6443:Gramd3 UTSW 18 56485385 missense probably benign 0.00
R6672:Gramd3 UTSW 18 56432336 missense possibly damaging 0.49
R7030:Gramd3 UTSW 18 56485249 missense probably damaging 1.00
R7099:Gramd3 UTSW 18 56491945 missense probably benign 0.01
R7162:Gramd3 UTSW 18 56485457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGCTGTCACTTTGCTTCGACC -3'
(R):5'- CACCGGATTGCCGGATAGACAATG -3'

Sequencing Primer
(F):5'- CAGCTCGGACCAATCGC -3'
(R):5'- gaggagaggaagggaggag -3'
Posted On2014-04-24