Mutagenetix > Incidental Mutation

Incidental Mutation 'R1624:Zdbf2'

174846

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

039661-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R1624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63303859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 466 (T466A)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: T466A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: T466A

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: T466A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: T466A

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 95.9%
20x: 91.4%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	T	C	16: 21,653,746	Y68C	probably damaging	Het
6820408C15Rik	A	T	2: 152,434,111	H81L	probably damaging	Het
Acbd4	A	G	11: 103,103,959	T48A	probably damaging	Het
Acpp	T	A	9: 104,320,001	E146D	probably benign	Het
Acsm1	T	A	7: 119,652,573	I307N	probably damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agl	T	C	3: 116,787,246	T356A	probably benign	Het
Ago1	A	G	4: 126,463,741	I47T	probably damaging	Het
Akr1c6	T	A	13: 4,446,364	Y75N	probably benign	Het
Anxa2	T	A	9: 69,479,708	S92T	probably benign	Het
Arid4b	T	C	13: 14,184,394	S585P	probably damaging	Het
Arl4d	T	C	11: 101,667,016	S123P	possibly damaging	Het
Atad2	A	T	15: 58,100,019	D1067E	probably damaging	Het
Brap	C	A	5: 121,682,859	T403K	possibly damaging	Het
Brwd1	A	T	16: 96,008,144	N1895K	possibly damaging	Het
Ccdc187	T	C	2: 26,281,075	T464A	probably benign	Het
Cdh11	T	C	8: 102,664,601		probably benign	Het
Chd9	A	T	8: 90,998,535	Y691F	probably benign	Het
Clhc1	A	T	11: 29,569,287	I365F	possibly damaging	Het
Col11a1	A	G	3: 114,158,155	Q1078R	probably damaging	Het
Creb3	G	A	4: 43,566,375	V294I	possibly damaging	Het
Cspg4	T	C	9: 56,888,470	I1163T	probably damaging	Het
Cyp3a57	A	C	5: 145,390,415		probably null	Het
Dnah3	A	T	7: 120,019,695	I1661N	probably damaging	Het
Dpysl4	A	C	7: 139,089,553	D49A	probably damaging	Het
Efhb	T	A	17: 53,426,278	I522F	probably damaging	Het
Epha4	T	C	1: 77,399,692	T517A	probably damaging	Het
Fasn	A	G	11: 120,813,111	S1466P	probably damaging	Het
Fgd6	A	T	10: 94,137,436	D1253V	probably benign	Het
Fjx1	G	A	2: 102,451,164	A142V	probably benign	Het
Foxb1	T	C	9: 69,759,316	T311A	probably benign	Het
Fpgs	A	G	2: 32,691,188		probably null	Het
Gm10024	A	G	10: 77,711,772		probably null	Het
Gnat3	A	T	5: 18,003,843	T182S	possibly damaging	Het
Igsf3	T	A	3: 101,455,227	F875I	probably benign	Het
Kif13b	A	G	14: 64,738,619	E461G	probably damaging	Het
Kif23	A	T	9: 61,925,700		probably null	Het
Kntc1	G	A	5: 123,758,477	R134Q	possibly damaging	Het
Krt33a	A	T	11: 100,014,246	Y145N	probably damaging	Het
Lama5	A	G	2: 180,206,758	V313A	probably benign	Het
Lamb1	T	C	12: 31,278,652		probably null	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mtor	C	T	4: 148,547,676	L2336F	probably damaging	Het
Naglu	T	C	11: 101,076,525	S434P	probably damaging	Het
Ncoa7	T	A	10: 30,704,659	H101L	possibly damaging	Het
Nlrc4	G	A	17: 74,445,189	T733I	possibly damaging	Het
Nr3c2	A	G	8: 76,909,944	E558G	probably damaging	Het
Nsun4	A	T	4: 116,034,200	N327K	probably benign	Het
Olfr1310	T	A	2: 112,008,532	Y218F	probably damaging	Het
Olfr165	T	A	16: 19,407,704	Y104F	probably benign	Het
Olfr524	T	C	7: 140,201,951	N273S	probably damaging	Het
Olfr54	T	C	11: 51,027,125	V41A	probably damaging	Het
Olfr743	A	G	14: 50,533,643	Y77C	probably damaging	Het
Pdia2	T	A	17: 26,196,521	I441F	probably damaging	Het
Phyh	T	C	2: 4,925,683	S74P	probably benign	Het
Pigo	A	G	4: 43,024,661	L146P	probably damaging	Het
Plce1	A	G	19: 38,724,775	D1191G	probably damaging	Het
Plrg1	G	A	3: 83,069,744	R364Q	probably damaging	Het
Plrg1	T	C	3: 83,067,994		probably benign	Het
Polr3b	T	C	10: 84,679,805	L614S	probably damaging	Het
Pramef25	A	T	4: 143,949,830	C235S	possibly damaging	Het
Prrg4	A	G	2: 104,832,682	V193A	probably damaging	Het
Prss16	T	A	13: 22,003,313	E47V	probably benign	Het
Ptpru	G	A	4: 131,772,550	T1261I	probably damaging	Het
Pycard	A	G	7: 127,992,798	S124P	possibly damaging	Het
Riok1	C	A	13: 38,037,511	D17E	probably damaging	Het
Scin	T	A	12: 40,127,930	Y102F	probably benign	Het
Scmh1	A	G	4: 120,529,228	H655R	probably damaging	Het
Scyl2	A	T	10: 89,640,736	N842K	probably benign	Het
Sec23b	T	A	2: 144,567,129	M211K	probably benign	Het
Serpina3i	A	C	12: 104,268,638	*409C	probably null	Het
Sgk2	G	A	2: 162,997,859	R129H	probably benign	Het
Slc39a13	A	G	2: 91,068,526	I80T	probably damaging	Het
Smarcad1	A	G	6: 65,052,647	D73G	probably benign	Het
Spata18	A	C	5: 73,669,545	T276P	probably damaging	Het
Srgap1	T	G	10: 121,855,373	M319L	probably benign	Het
Stx7	T	A	10: 24,185,005	V210E	probably damaging	Het
Tjp2	T	A	19: 24,131,412	H112L	probably benign	Het
Tuba8	A	T	6: 121,220,426	I16F	probably damaging	Het
Ube3c	G	A	5: 29,646,619	A815T	probably benign	Het
Vmn2r5	A	T	3: 64,509,695	V14E	probably benign	Het
Vmn2r79	A	T	7: 87,004,039		probably null	Het
Wisp3	G	A	10: 39,153,243	R230W	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTCCCAAGCTGCTGTACGTGAC -3'
(R):5'- ACGAAGGGGCACTACTACTTCCAC -3'

Sequencing Primer
(F):5'- aggaagaagaggaagaggagg -3'
(R):5'- ACTACTACTTCCACGGGCTG -3'

Posted On

2014-04-24