Incidental Mutation 'R1624:Ptpru'
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission 039661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1624 (G1)
Quality Score163
Status Validated
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131772550 bp
Amino Acid Change Threonine to Isoleucine at position 1261 (T1261I)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: T1271I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: T1271I

signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: T1261I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: T1261I

signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144136
Meta Mutation Damage Score 0.8213 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T C 16: 21,653,746 Y68C probably damaging Het
6820408C15Rik A T 2: 152,434,111 H81L probably damaging Het
Acbd4 A G 11: 103,103,959 T48A probably damaging Het
Acpp T A 9: 104,320,001 E146D probably benign Het
Acsm1 T A 7: 119,652,573 I307N probably damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agl T C 3: 116,787,246 T356A probably benign Het
Ago1 A G 4: 126,463,741 I47T probably damaging Het
Akr1c6 T A 13: 4,446,364 Y75N probably benign Het
Anxa2 T A 9: 69,479,708 S92T probably benign Het
Arid4b T C 13: 14,184,394 S585P probably damaging Het
Arl4d T C 11: 101,667,016 S123P possibly damaging Het
Atad2 A T 15: 58,100,019 D1067E probably damaging Het
Brap C A 5: 121,682,859 T403K possibly damaging Het
Brwd1 A T 16: 96,008,144 N1895K possibly damaging Het
Ccdc187 T C 2: 26,281,075 T464A probably benign Het
Cdh11 T C 8: 102,664,601 probably benign Het
Chd9 A T 8: 90,998,535 Y691F probably benign Het
Clhc1 A T 11: 29,569,287 I365F possibly damaging Het
Col11a1 A G 3: 114,158,155 Q1078R probably damaging Het
Creb3 G A 4: 43,566,375 V294I possibly damaging Het
Cspg4 T C 9: 56,888,470 I1163T probably damaging Het
Cyp3a57 A C 5: 145,390,415 probably null Het
Dnah3 A T 7: 120,019,695 I1661N probably damaging Het
Dpysl4 A C 7: 139,089,553 D49A probably damaging Het
Efhb T A 17: 53,426,278 I522F probably damaging Het
Epha4 T C 1: 77,399,692 T517A probably damaging Het
Fasn A G 11: 120,813,111 S1466P probably damaging Het
Fgd6 A T 10: 94,137,436 D1253V probably benign Het
Fjx1 G A 2: 102,451,164 A142V probably benign Het
Foxb1 T C 9: 69,759,316 T311A probably benign Het
Fpgs A G 2: 32,691,188 probably null Het
Gm10024 A G 10: 77,711,772 probably null Het
Gnat3 A T 5: 18,003,843 T182S possibly damaging Het
Igsf3 T A 3: 101,455,227 F875I probably benign Het
Kif13b A G 14: 64,738,619 E461G probably damaging Het
Kif23 A T 9: 61,925,700 probably null Het
Kntc1 G A 5: 123,758,477 R134Q possibly damaging Het
Krt33a A T 11: 100,014,246 Y145N probably damaging Het
Lama5 A G 2: 180,206,758 V313A probably benign Het
Lamb1 T C 12: 31,278,652 probably null Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mtor C T 4: 148,547,676 L2336F probably damaging Het
Naglu T C 11: 101,076,525 S434P probably damaging Het
Ncoa7 T A 10: 30,704,659 H101L possibly damaging Het
Nlrc4 G A 17: 74,445,189 T733I possibly damaging Het
Nr3c2 A G 8: 76,909,944 E558G probably damaging Het
Nsun4 A T 4: 116,034,200 N327K probably benign Het
Olfr1310 T A 2: 112,008,532 Y218F probably damaging Het
Olfr165 T A 16: 19,407,704 Y104F probably benign Het
Olfr524 T C 7: 140,201,951 N273S probably damaging Het
Olfr54 T C 11: 51,027,125 V41A probably damaging Het
Olfr743 A G 14: 50,533,643 Y77C probably damaging Het
Pdia2 T A 17: 26,196,521 I441F probably damaging Het
Phyh T C 2: 4,925,683 S74P probably benign Het
Pigo A G 4: 43,024,661 L146P probably damaging Het
Plce1 A G 19: 38,724,775 D1191G probably damaging Het
Plrg1 T C 3: 83,067,994 probably benign Het
Plrg1 G A 3: 83,069,744 R364Q probably damaging Het
Polr3b T C 10: 84,679,805 L614S probably damaging Het
Pramef25 A T 4: 143,949,830 C235S possibly damaging Het
Prrg4 A G 2: 104,832,682 V193A probably damaging Het
Prss16 T A 13: 22,003,313 E47V probably benign Het
Pycard A G 7: 127,992,798 S124P possibly damaging Het
Riok1 C A 13: 38,037,511 D17E probably damaging Het
Scin T A 12: 40,127,930 Y102F probably benign Het
Scmh1 A G 4: 120,529,228 H655R probably damaging Het
Scyl2 A T 10: 89,640,736 N842K probably benign Het
Sec23b T A 2: 144,567,129 M211K probably benign Het
Serpina3i A C 12: 104,268,638 *409C probably null Het
Sgk2 G A 2: 162,997,859 R129H probably benign Het
Slc39a13 A G 2: 91,068,526 I80T probably damaging Het
Smarcad1 A G 6: 65,052,647 D73G probably benign Het
Spata18 A C 5: 73,669,545 T276P probably damaging Het
Srgap1 T G 10: 121,855,373 M319L probably benign Het
Stx7 T A 10: 24,185,005 V210E probably damaging Het
Tjp2 T A 19: 24,131,412 H112L probably benign Het
Tuba8 A T 6: 121,220,426 I16F probably damaging Het
Ube3c G A 5: 29,646,619 A815T probably benign Het
Vmn2r5 A T 3: 64,509,695 V14E probably benign Het
Vmn2r79 A T 7: 87,004,039 probably null Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zdbf2 A G 1: 63,303,859 T466A possibly damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8355:Ptpru UTSW 4 131808500 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
R8416:Ptpru UTSW 4 131808472 missense probably damaging 1.00
R8911:Ptpru UTSW 4 131776249 missense probably damaging 0.96
R8934:Ptpru UTSW 4 131818986 missense probably damaging 0.98
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctcttctctgttggtcttaattc -3'
Posted On2014-04-24