Mutagenetix > Incidental Mutation

Incidental Mutation 'R1624:Ptpru'

174869

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

039661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1624 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 131772550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1261 (T1261I)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]

AlphaFold

B1AUH1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030741
AA Change: T1271I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: T1271I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105987
AA Change: T1261I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: T1261I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144136

Meta Mutation Damage Score

0.8213

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 95.9%
20x: 91.4%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	T	C	16: 21,653,746	Y68C	probably damaging	Het
6820408C15Rik	A	T	2: 152,434,111	H81L	probably damaging	Het
Acbd4	A	G	11: 103,103,959	T48A	probably damaging	Het
Acpp	T	A	9: 104,320,001	E146D	probably benign	Het
Acsm1	T	A	7: 119,652,573	I307N	probably damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agl	T	C	3: 116,787,246	T356A	probably benign	Het
Ago1	A	G	4: 126,463,741	I47T	probably damaging	Het
Akr1c6	T	A	13: 4,446,364	Y75N	probably benign	Het
Anxa2	T	A	9: 69,479,708	S92T	probably benign	Het
Arid4b	T	C	13: 14,184,394	S585P	probably damaging	Het
Arl4d	T	C	11: 101,667,016	S123P	possibly damaging	Het
Atad2	A	T	15: 58,100,019	D1067E	probably damaging	Het
Brap	C	A	5: 121,682,859	T403K	possibly damaging	Het
Brwd1	A	T	16: 96,008,144	N1895K	possibly damaging	Het
Ccdc187	T	C	2: 26,281,075	T464A	probably benign	Het
Cdh11	T	C	8: 102,664,601		probably benign	Het
Chd9	A	T	8: 90,998,535	Y691F	probably benign	Het
Clhc1	A	T	11: 29,569,287	I365F	possibly damaging	Het
Col11a1	A	G	3: 114,158,155	Q1078R	probably damaging	Het
Creb3	G	A	4: 43,566,375	V294I	possibly damaging	Het
Cspg4	T	C	9: 56,888,470	I1163T	probably damaging	Het
Cyp3a57	A	C	5: 145,390,415		probably null	Het
Dnah3	A	T	7: 120,019,695	I1661N	probably damaging	Het
Dpysl4	A	C	7: 139,089,553	D49A	probably damaging	Het
Efhb	T	A	17: 53,426,278	I522F	probably damaging	Het
Epha4	T	C	1: 77,399,692	T517A	probably damaging	Het
Fasn	A	G	11: 120,813,111	S1466P	probably damaging	Het
Fgd6	A	T	10: 94,137,436	D1253V	probably benign	Het
Fjx1	G	A	2: 102,451,164	A142V	probably benign	Het
Foxb1	T	C	9: 69,759,316	T311A	probably benign	Het
Fpgs	A	G	2: 32,691,188		probably null	Het
Gm10024	A	G	10: 77,711,772		probably null	Het
Gnat3	A	T	5: 18,003,843	T182S	possibly damaging	Het
Igsf3	T	A	3: 101,455,227	F875I	probably benign	Het
Kif13b	A	G	14: 64,738,619	E461G	probably damaging	Het
Kif23	A	T	9: 61,925,700		probably null	Het
Kntc1	G	A	5: 123,758,477	R134Q	possibly damaging	Het
Krt33a	A	T	11: 100,014,246	Y145N	probably damaging	Het
Lama5	A	G	2: 180,206,758	V313A	probably benign	Het
Lamb1	T	C	12: 31,278,652		probably null	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mtor	C	T	4: 148,547,676	L2336F	probably damaging	Het
Naglu	T	C	11: 101,076,525	S434P	probably damaging	Het
Ncoa7	T	A	10: 30,704,659	H101L	possibly damaging	Het
Nlrc4	G	A	17: 74,445,189	T733I	possibly damaging	Het
Nr3c2	A	G	8: 76,909,944	E558G	probably damaging	Het
Nsun4	A	T	4: 116,034,200	N327K	probably benign	Het
Olfr1310	T	A	2: 112,008,532	Y218F	probably damaging	Het
Olfr165	T	A	16: 19,407,704	Y104F	probably benign	Het
Olfr524	T	C	7: 140,201,951	N273S	probably damaging	Het
Olfr54	T	C	11: 51,027,125	V41A	probably damaging	Het
Olfr743	A	G	14: 50,533,643	Y77C	probably damaging	Het
Pdia2	T	A	17: 26,196,521	I441F	probably damaging	Het
Phyh	T	C	2: 4,925,683	S74P	probably benign	Het
Pigo	A	G	4: 43,024,661	L146P	probably damaging	Het
Plce1	A	G	19: 38,724,775	D1191G	probably damaging	Het
Plrg1	T	C	3: 83,067,994		probably benign	Het
Plrg1	G	A	3: 83,069,744	R364Q	probably damaging	Het
Polr3b	T	C	10: 84,679,805	L614S	probably damaging	Het
Pramef25	A	T	4: 143,949,830	C235S	possibly damaging	Het
Prrg4	A	G	2: 104,832,682	V193A	probably damaging	Het
Prss16	T	A	13: 22,003,313	E47V	probably benign	Het
Pycard	A	G	7: 127,992,798	S124P	possibly damaging	Het
Riok1	C	A	13: 38,037,511	D17E	probably damaging	Het
Scin	T	A	12: 40,127,930	Y102F	probably benign	Het
Scmh1	A	G	4: 120,529,228	H655R	probably damaging	Het
Scyl2	A	T	10: 89,640,736	N842K	probably benign	Het
Sec23b	T	A	2: 144,567,129	M211K	probably benign	Het
Serpina3i	A	C	12: 104,268,638	*409C	probably null	Het
Sgk2	G	A	2: 162,997,859	R129H	probably benign	Het
Slc39a13	A	G	2: 91,068,526	I80T	probably damaging	Het
Smarcad1	A	G	6: 65,052,647	D73G	probably benign	Het
Spata18	A	C	5: 73,669,545	T276P	probably damaging	Het
Srgap1	T	G	10: 121,855,373	M319L	probably benign	Het
Stx7	T	A	10: 24,185,005	V210E	probably damaging	Het
Tjp2	T	A	19: 24,131,412	H112L	probably benign	Het
Tuba8	A	T	6: 121,220,426	I16F	probably damaging	Het
Ube3c	G	A	5: 29,646,619	A815T	probably benign	Het
Vmn2r5	A	T	3: 64,509,695	V14E	probably benign	Het
Vmn2r79	A	T	7: 87,004,039		probably null	Het
Wisp3	G	A	10: 39,153,243	R230W	probably damaging	Het
Zdbf2	A	G	1: 63,303,859	T466A	possibly damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
R8858:Ptpru	UTSW	4	131799514	splice site	probably benign
R8911:Ptpru	UTSW	4	131776249	missense	probably damaging	0.96
R8934:Ptpru	UTSW	4	131818986	missense	probably damaging	0.98
R9031:Ptpru	UTSW	4	131788380	missense	probably damaging	1.00
R9069:Ptpru	UTSW	4	131776254	missense	possibly damaging	0.87
R9096:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9097:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9151:Ptpru	UTSW	4	131794967	missense	probably benign
R9166:Ptpru	UTSW	4	131797869	missense	probably benign	0.00
R9174:Ptpru	UTSW	4	131808435	missense	probably damaging	1.00
R9242:Ptpru	UTSW	4	131803030	missense	probably damaging	1.00
R9698:Ptpru	UTSW	4	131820220	missense	probably benign	0.09
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCACTATGTGACCCTGGAGAAAG -3'
(R):5'- ACCCATGTGAGAGTACTGGCTTCTG -3'

Sequencing Primer
(F):5'- cctcttctctgttggtcttaattc -3'
(R):5'- CTGGGAGGCACTGCTTG -3'

Posted On

2014-04-24