Incidental Mutation 'R1624:Polr3b'
ID 174902
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission 039661-MU
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1624 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84679805 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 614 (L614S)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably damaging
Transcript: ENSMUST00000077175
AA Change: L614S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: L614S

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T C 16: 21,653,746 Y68C probably damaging Het
6820408C15Rik A T 2: 152,434,111 H81L probably damaging Het
Acbd4 A G 11: 103,103,959 T48A probably damaging Het
Acpp T A 9: 104,320,001 E146D probably benign Het
Acsm1 T A 7: 119,652,573 I307N probably damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agl T C 3: 116,787,246 T356A probably benign Het
Ago1 A G 4: 126,463,741 I47T probably damaging Het
Akr1c6 T A 13: 4,446,364 Y75N probably benign Het
Anxa2 T A 9: 69,479,708 S92T probably benign Het
Arid4b T C 13: 14,184,394 S585P probably damaging Het
Arl4d T C 11: 101,667,016 S123P possibly damaging Het
Atad2 A T 15: 58,100,019 D1067E probably damaging Het
Brap C A 5: 121,682,859 T403K possibly damaging Het
Brwd1 A T 16: 96,008,144 N1895K possibly damaging Het
Ccdc187 T C 2: 26,281,075 T464A probably benign Het
Cdh11 T C 8: 102,664,601 probably benign Het
Chd9 A T 8: 90,998,535 Y691F probably benign Het
Clhc1 A T 11: 29,569,287 I365F possibly damaging Het
Col11a1 A G 3: 114,158,155 Q1078R probably damaging Het
Creb3 G A 4: 43,566,375 V294I possibly damaging Het
Cspg4 T C 9: 56,888,470 I1163T probably damaging Het
Cyp3a57 A C 5: 145,390,415 probably null Het
Dnah3 A T 7: 120,019,695 I1661N probably damaging Het
Dpysl4 A C 7: 139,089,553 D49A probably damaging Het
Efhb T A 17: 53,426,278 I522F probably damaging Het
Epha4 T C 1: 77,399,692 T517A probably damaging Het
Fasn A G 11: 120,813,111 S1466P probably damaging Het
Fgd6 A T 10: 94,137,436 D1253V probably benign Het
Fjx1 G A 2: 102,451,164 A142V probably benign Het
Foxb1 T C 9: 69,759,316 T311A probably benign Het
Fpgs A G 2: 32,691,188 probably null Het
Gm10024 A G 10: 77,711,772 probably null Het
Gnat3 A T 5: 18,003,843 T182S possibly damaging Het
Igsf3 T A 3: 101,455,227 F875I probably benign Het
Kif13b A G 14: 64,738,619 E461G probably damaging Het
Kif23 A T 9: 61,925,700 probably null Het
Kntc1 G A 5: 123,758,477 R134Q possibly damaging Het
Krt33a A T 11: 100,014,246 Y145N probably damaging Het
Lama5 A G 2: 180,206,758 V313A probably benign Het
Lamb1 T C 12: 31,278,652 probably null Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mtor C T 4: 148,547,676 L2336F probably damaging Het
Naglu T C 11: 101,076,525 S434P probably damaging Het
Ncoa7 T A 10: 30,704,659 H101L possibly damaging Het
Nlrc4 G A 17: 74,445,189 T733I possibly damaging Het
Nr3c2 A G 8: 76,909,944 E558G probably damaging Het
Nsun4 A T 4: 116,034,200 N327K probably benign Het
Olfr1310 T A 2: 112,008,532 Y218F probably damaging Het
Olfr165 T A 16: 19,407,704 Y104F probably benign Het
Olfr524 T C 7: 140,201,951 N273S probably damaging Het
Olfr54 T C 11: 51,027,125 V41A probably damaging Het
Olfr743 A G 14: 50,533,643 Y77C probably damaging Het
Pdia2 T A 17: 26,196,521 I441F probably damaging Het
Phyh T C 2: 4,925,683 S74P probably benign Het
Pigo A G 4: 43,024,661 L146P probably damaging Het
Plce1 A G 19: 38,724,775 D1191G probably damaging Het
Plrg1 T C 3: 83,067,994 probably benign Het
Plrg1 G A 3: 83,069,744 R364Q probably damaging Het
Pramef25 A T 4: 143,949,830 C235S possibly damaging Het
Prrg4 A G 2: 104,832,682 V193A probably damaging Het
Prss16 T A 13: 22,003,313 E47V probably benign Het
Ptpru G A 4: 131,772,550 T1261I probably damaging Het
Pycard A G 7: 127,992,798 S124P possibly damaging Het
Riok1 C A 13: 38,037,511 D17E probably damaging Het
Scin T A 12: 40,127,930 Y102F probably benign Het
Scmh1 A G 4: 120,529,228 H655R probably damaging Het
Scyl2 A T 10: 89,640,736 N842K probably benign Het
Sec23b T A 2: 144,567,129 M211K probably benign Het
Serpina3i A C 12: 104,268,638 *409C probably null Het
Sgk2 G A 2: 162,997,859 R129H probably benign Het
Slc39a13 A G 2: 91,068,526 I80T probably damaging Het
Smarcad1 A G 6: 65,052,647 D73G probably benign Het
Spata18 A C 5: 73,669,545 T276P probably damaging Het
Srgap1 T G 10: 121,855,373 M319L probably benign Het
Stx7 T A 10: 24,185,005 V210E probably damaging Het
Tjp2 T A 19: 24,131,412 H112L probably benign Het
Tuba8 A T 6: 121,220,426 I16F probably damaging Het
Ube3c G A 5: 29,646,619 A815T probably benign Het
Vmn2r5 A T 3: 64,509,695 V14E probably benign Het
Vmn2r79 A T 7: 87,004,039 probably null Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zdbf2 A G 1: 63,303,859 T466A possibly damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGTCAAGCAACCAGAGCAAG -3'
(R):5'- CACATTAGCAGTGTGTCTACAGGGG -3'

Sequencing Primer
(F):5'- AGAGCAAGCTGTGTGTCTCC -3'
(R):5'- GGTGAGCACTTCATCACATGC -3'
Posted On 2014-04-24