Incidental Mutation 'R1624:Fgd6'
ID174904
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
MMRRC Submission 039661-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1624 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94137436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1253 (D1253V)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020208
AA Change: D1253V

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: D1253V

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125535
Meta Mutation Damage Score 0.1718 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T C 16: 21,653,746 Y68C probably damaging Het
6820408C15Rik A T 2: 152,434,111 H81L probably damaging Het
Acbd4 A G 11: 103,103,959 T48A probably damaging Het
Acpp T A 9: 104,320,001 E146D probably benign Het
Acsm1 T A 7: 119,652,573 I307N probably damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agl T C 3: 116,787,246 T356A probably benign Het
Ago1 A G 4: 126,463,741 I47T probably damaging Het
Akr1c6 T A 13: 4,446,364 Y75N probably benign Het
Anxa2 T A 9: 69,479,708 S92T probably benign Het
Arid4b T C 13: 14,184,394 S585P probably damaging Het
Arl4d T C 11: 101,667,016 S123P possibly damaging Het
Atad2 A T 15: 58,100,019 D1067E probably damaging Het
Brap C A 5: 121,682,859 T403K possibly damaging Het
Brwd1 A T 16: 96,008,144 N1895K possibly damaging Het
Ccdc187 T C 2: 26,281,075 T464A probably benign Het
Cdh11 T C 8: 102,664,601 probably benign Het
Chd9 A T 8: 90,998,535 Y691F probably benign Het
Clhc1 A T 11: 29,569,287 I365F possibly damaging Het
Col11a1 A G 3: 114,158,155 Q1078R probably damaging Het
Creb3 G A 4: 43,566,375 V294I possibly damaging Het
Cspg4 T C 9: 56,888,470 I1163T probably damaging Het
Cyp3a57 A C 5: 145,390,415 probably null Het
Dnah3 A T 7: 120,019,695 I1661N probably damaging Het
Dpysl4 A C 7: 139,089,553 D49A probably damaging Het
Efhb T A 17: 53,426,278 I522F probably damaging Het
Epha4 T C 1: 77,399,692 T517A probably damaging Het
Fasn A G 11: 120,813,111 S1466P probably damaging Het
Fjx1 G A 2: 102,451,164 A142V probably benign Het
Foxb1 T C 9: 69,759,316 T311A probably benign Het
Fpgs A G 2: 32,691,188 probably null Het
Gm10024 A G 10: 77,711,772 probably null Het
Gnat3 A T 5: 18,003,843 T182S possibly damaging Het
Igsf3 T A 3: 101,455,227 F875I probably benign Het
Kif13b A G 14: 64,738,619 E461G probably damaging Het
Kif23 A T 9: 61,925,700 probably null Het
Kntc1 G A 5: 123,758,477 R134Q possibly damaging Het
Krt33a A T 11: 100,014,246 Y145N probably damaging Het
Lama5 A G 2: 180,206,758 V313A probably benign Het
Lamb1 T C 12: 31,278,652 probably null Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mtor C T 4: 148,547,676 L2336F probably damaging Het
Naglu T C 11: 101,076,525 S434P probably damaging Het
Ncoa7 T A 10: 30,704,659 H101L possibly damaging Het
Nlrc4 G A 17: 74,445,189 T733I possibly damaging Het
Nr3c2 A G 8: 76,909,944 E558G probably damaging Het
Nsun4 A T 4: 116,034,200 N327K probably benign Het
Olfr1310 T A 2: 112,008,532 Y218F probably damaging Het
Olfr165 T A 16: 19,407,704 Y104F probably benign Het
Olfr524 T C 7: 140,201,951 N273S probably damaging Het
Olfr54 T C 11: 51,027,125 V41A probably damaging Het
Olfr743 A G 14: 50,533,643 Y77C probably damaging Het
Pdia2 T A 17: 26,196,521 I441F probably damaging Het
Phyh T C 2: 4,925,683 S74P probably benign Het
Pigo A G 4: 43,024,661 L146P probably damaging Het
Plce1 A G 19: 38,724,775 D1191G probably damaging Het
Plrg1 T C 3: 83,067,994 probably benign Het
Plrg1 G A 3: 83,069,744 R364Q probably damaging Het
Polr3b T C 10: 84,679,805 L614S probably damaging Het
Pramef25 A T 4: 143,949,830 C235S possibly damaging Het
Prrg4 A G 2: 104,832,682 V193A probably damaging Het
Prss16 T A 13: 22,003,313 E47V probably benign Het
Ptpru G A 4: 131,772,550 T1261I probably damaging Het
Pycard A G 7: 127,992,798 S124P possibly damaging Het
Riok1 C A 13: 38,037,511 D17E probably damaging Het
Scin T A 12: 40,127,930 Y102F probably benign Het
Scmh1 A G 4: 120,529,228 H655R probably damaging Het
Scyl2 A T 10: 89,640,736 N842K probably benign Het
Sec23b T A 2: 144,567,129 M211K probably benign Het
Serpina3i A C 12: 104,268,638 *409C probably null Het
Sgk2 G A 2: 162,997,859 R129H probably benign Het
Slc39a13 A G 2: 91,068,526 I80T probably damaging Het
Smarcad1 A G 6: 65,052,647 D73G probably benign Het
Spata18 A C 5: 73,669,545 T276P probably damaging Het
Srgap1 T G 10: 121,855,373 M319L probably benign Het
Stx7 T A 10: 24,185,005 V210E probably damaging Het
Tjp2 T A 19: 24,131,412 H112L probably benign Het
Tuba8 A T 6: 121,220,426 I16F probably damaging Het
Ube3c G A 5: 29,646,619 A815T probably benign Het
Vmn2r5 A T 3: 64,509,695 V14E probably benign Het
Vmn2r79 A T 7: 87,004,039 probably null Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zdbf2 A G 1: 63,303,859 T466A possibly damaging Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 94043511 missense probably benign 0.02
R7210:Fgd6 UTSW 10 94134092 missense probably damaging 0.98
R7296:Fgd6 UTSW 10 94044047 nonsense probably null
R7296:Fgd6 UTSW 10 94139881 missense probably benign 0.02
R7697:Fgd6 UTSW 10 94045444 missense probably damaging 0.99
R7747:Fgd6 UTSW 10 94044916 missense probably damaging 1.00
R7861:Fgd6 UTSW 10 94103331 missense probably benign 0.15
R7940:Fgd6 UTSW 10 94120482 missense probably benign 0.02
R8022:Fgd6 UTSW 10 94044344 missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 94134143 missense probably null 0.45
R8171:Fgd6 UTSW 10 94074332 critical splice donor site probably null
R8189:Fgd6 UTSW 10 94074215 missense probably benign 0.00
R8213:Fgd6 UTSW 10 94044052 missense probably benign 0.37
RF031:Fgd6 UTSW 10 94044325 frame shift probably null
RF040:Fgd6 UTSW 10 94044325 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGACCCGCCCTTACCCAGATATTG -3'
(R):5'- CCATTCTTTATGAAAGGCAGCCCCG -3'

Sequencing Primer
(F):5'- ccctcctacctccatctcc -3'
(R):5'- CGGCAGCCTTAACGGAAAG -3'
Posted On2014-04-24