Incidental Mutation 'R1624:Kif13b'
ID174923
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 039661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1624 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64738619 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 461 (E461G)
Ref Sequence ENSEMBL: ENSMUSP00000098041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably damaging
Transcript: ENSMUST00000100473
AA Change: E461G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: E461G

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224503
AA Change: E461G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.5184 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T C 16: 21,653,746 Y68C probably damaging Het
6820408C15Rik A T 2: 152,434,111 H81L probably damaging Het
Acbd4 A G 11: 103,103,959 T48A probably damaging Het
Acpp T A 9: 104,320,001 E146D probably benign Het
Acsm1 T A 7: 119,652,573 I307N probably damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agl T C 3: 116,787,246 T356A probably benign Het
Ago1 A G 4: 126,463,741 I47T probably damaging Het
Akr1c6 T A 13: 4,446,364 Y75N probably benign Het
Anxa2 T A 9: 69,479,708 S92T probably benign Het
Arid4b T C 13: 14,184,394 S585P probably damaging Het
Arl4d T C 11: 101,667,016 S123P possibly damaging Het
Atad2 A T 15: 58,100,019 D1067E probably damaging Het
Brap C A 5: 121,682,859 T403K possibly damaging Het
Brwd1 A T 16: 96,008,144 N1895K possibly damaging Het
Ccdc187 T C 2: 26,281,075 T464A probably benign Het
Cdh11 T C 8: 102,664,601 probably benign Het
Chd9 A T 8: 90,998,535 Y691F probably benign Het
Clhc1 A T 11: 29,569,287 I365F possibly damaging Het
Col11a1 A G 3: 114,158,155 Q1078R probably damaging Het
Creb3 G A 4: 43,566,375 V294I possibly damaging Het
Cspg4 T C 9: 56,888,470 I1163T probably damaging Het
Cyp3a57 A C 5: 145,390,415 probably null Het
Dnah3 A T 7: 120,019,695 I1661N probably damaging Het
Dpysl4 A C 7: 139,089,553 D49A probably damaging Het
Efhb T A 17: 53,426,278 I522F probably damaging Het
Epha4 T C 1: 77,399,692 T517A probably damaging Het
Fasn A G 11: 120,813,111 S1466P probably damaging Het
Fgd6 A T 10: 94,137,436 D1253V probably benign Het
Fjx1 G A 2: 102,451,164 A142V probably benign Het
Foxb1 T C 9: 69,759,316 T311A probably benign Het
Fpgs A G 2: 32,691,188 probably null Het
Gm10024 A G 10: 77,711,772 probably null Het
Gnat3 A T 5: 18,003,843 T182S possibly damaging Het
Igsf3 T A 3: 101,455,227 F875I probably benign Het
Kif23 A T 9: 61,925,700 probably null Het
Kntc1 G A 5: 123,758,477 R134Q possibly damaging Het
Krt33a A T 11: 100,014,246 Y145N probably damaging Het
Lama5 A G 2: 180,206,758 V313A probably benign Het
Lamb1 T C 12: 31,278,652 probably null Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mtor C T 4: 148,547,676 L2336F probably damaging Het
Naglu T C 11: 101,076,525 S434P probably damaging Het
Ncoa7 T A 10: 30,704,659 H101L possibly damaging Het
Nlrc4 G A 17: 74,445,189 T733I possibly damaging Het
Nr3c2 A G 8: 76,909,944 E558G probably damaging Het
Nsun4 A T 4: 116,034,200 N327K probably benign Het
Olfr1310 T A 2: 112,008,532 Y218F probably damaging Het
Olfr165 T A 16: 19,407,704 Y104F probably benign Het
Olfr524 T C 7: 140,201,951 N273S probably damaging Het
Olfr54 T C 11: 51,027,125 V41A probably damaging Het
Olfr743 A G 14: 50,533,643 Y77C probably damaging Het
Pdia2 T A 17: 26,196,521 I441F probably damaging Het
Phyh T C 2: 4,925,683 S74P probably benign Het
Pigo A G 4: 43,024,661 L146P probably damaging Het
Plce1 A G 19: 38,724,775 D1191G probably damaging Het
Plrg1 T C 3: 83,067,994 probably benign Het
Plrg1 G A 3: 83,069,744 R364Q probably damaging Het
Polr3b T C 10: 84,679,805 L614S probably damaging Het
Pramef25 A T 4: 143,949,830 C235S possibly damaging Het
Prrg4 A G 2: 104,832,682 V193A probably damaging Het
Prss16 T A 13: 22,003,313 E47V probably benign Het
Ptpru G A 4: 131,772,550 T1261I probably damaging Het
Pycard A G 7: 127,992,798 S124P possibly damaging Het
Riok1 C A 13: 38,037,511 D17E probably damaging Het
Scin T A 12: 40,127,930 Y102F probably benign Het
Scmh1 A G 4: 120,529,228 H655R probably damaging Het
Scyl2 A T 10: 89,640,736 N842K probably benign Het
Sec23b T A 2: 144,567,129 M211K probably benign Het
Serpina3i A C 12: 104,268,638 *409C probably null Het
Sgk2 G A 2: 162,997,859 R129H probably benign Het
Slc39a13 A G 2: 91,068,526 I80T probably damaging Het
Smarcad1 A G 6: 65,052,647 D73G probably benign Het
Spata18 A C 5: 73,669,545 T276P probably damaging Het
Srgap1 T G 10: 121,855,373 M319L probably benign Het
Stx7 T A 10: 24,185,005 V210E probably damaging Het
Tjp2 T A 19: 24,131,412 H112L probably benign Het
Tuba8 A T 6: 121,220,426 I16F probably damaging Het
Ube3c G A 5: 29,646,619 A815T probably benign Het
Vmn2r5 A T 3: 64,509,695 V14E probably benign Het
Vmn2r79 A T 7: 87,004,039 probably null Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zdbf2 A G 1: 63,303,859 T466A possibly damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGTGCTGGGAATCACCACT -3'
(R):5'- CCTCCTCAATGAGAAGCTGTGCTG -3'

Sequencing Primer
(F):5'- GGGAATCACCACTTCTCTGG -3'
(R):5'- ggcctggttcTTCAGTCTC -3'
Posted On2014-04-24