Incidental Mutation 'R1625:Adipor1'
ID174937
Institutional Source Beutler Lab
Gene Symbol Adipor1
Ensembl Gene ENSMUSG00000026457
Gene Nameadiponectin receptor 1
Synonyms
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1625 (G1)
Quality Score221
Status Not validated
Chromosome1
Chromosomal Location134415378-134433351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134424064 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000107856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027727] [ENSMUST00000112237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027727
AA Change: F83S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027727
Gene: ENSMUSG00000026457
AA Change: F83S

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 2.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112237
AA Change: F83S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107856
Gene: ENSMUSG00000026457
AA Change: F83S

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 7.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148822
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor for the fat-derived hormone adiponectin. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. Homozygous knockout mice for this gene exhibit elevated plasma glucose and insulin levels as well as impaired glucose tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal homeostasis, adipose tissue morphology and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Dock7 C T 4: 98,962,196 probably null Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Hspg2 G A 4: 137,518,971 S1020N probably benign Het
Kif21a A G 15: 90,942,175 S1360P probably damaging Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Rab11fip3 T C 17: 26,068,891 E96G possibly damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Sppl2c C A 11: 104,187,169 T265K probably damaging Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Adipor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Adipor1 APN 1 134431185 missense probably benign 0.07
IGL02186:Adipor1 APN 1 134425960 missense probably benign 0.02
IGL03365:Adipor1 APN 1 134431642 missense possibly damaging 0.67
R0898:Adipor1 UTSW 1 134424076 critical splice donor site probably null
R1938:Adipor1 UTSW 1 134423103 missense probably benign 0.03
R1956:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1957:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1958:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R2921:Adipor1 UTSW 1 134425993 missense possibly damaging 0.90
R4666:Adipor1 UTSW 1 134424905 missense probably damaging 1.00
R5560:Adipor1 UTSW 1 134426040 missense possibly damaging 0.69
R5795:Adipor1 UTSW 1 134424903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGAAACGTGCAGTTTAGGAG -3'
(R):5'- TGTGTGGGCATACAAGTGCAACAG -3'

Sequencing Primer
(F):5'- AAACGTGCAGTTTAGGAGTTGATG -3'
(R):5'- TTTTTAACCACGAGGATCAAGGG -3'
Posted On2014-04-24