Mutagenetix > Incidental Mutation

Incidental Mutation 'R1625:Gucy1a1'

174945

Institutional Source

Beutler Lab

Gene Symbol

Gucy1a1

Ensembl Gene

ENSMUSG00000033910

Gene Name

guanylate cyclase 1, soluble, alpha 1

Synonyms

sGC-alpha1, alpha 1 sGC, 1200016O07Rik

MMRRC Submission

039662-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R1625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82092427-82145789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82102055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 549 (I549V)

Ref Sequence

ENSEMBL: ENSMUSP00000142138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]

AlphaFold

Q9ERL9

Predicted Effect

probably benign
Transcript: ENSMUST00000048976
AA Change: I549V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: I549V

Domain	Start	End	E-Value	Type
Pfam:HNOB	85	235	2.5e-8	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191942

Predicted Effect

unknown
Transcript: ENSMUST00000192289
AA Change: I19V

Predicted Effect

probably benign
Transcript: ENSMUST00000193924
AA Change: I549V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: I549V

Domain	Start	End	E-Value	Type
Pfam:HNOB	73	237	1.6e-7	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,431,668	Y655H	probably damaging	Het
Abca8b	T	A	11: 109,967,121	M605L	probably benign	Het
Abcc5	A	T	16: 20,365,817	S1031T	probably damaging	Het
Acot7	T	A	4: 152,186,291	C31S	probably benign	Het
Acss3	A	T	10: 106,937,402		probably null	Het
Adipor1	T	C	1: 134,424,064	F83S	possibly damaging	Het
Agrn	G	A	4: 156,172,860	S1171L	probably damaging	Het
Arhgap5	T	A	12: 52,517,376	C377S	probably benign	Het
Arid4b	T	A	13: 14,187,114	V721D	probably damaging	Het
Aspm	G	A	1: 139,481,039	A2555T	probably benign	Het
Atp6v0a1	T	A	11: 101,055,554	L791Q	probably damaging	Het
Car11	A	G	7: 45,701,307	K76E	probably benign	Het
Casp8ap2	T	A	4: 32,648,068	M1925K	probably benign	Het
Cc2d1a	A	T	8: 84,139,372	L418Q	probably damaging	Het
Ccl9	G	A	11: 83,575,910	R64W	probably damaging	Het
Cfap43	T	A	19: 47,751,088	K1325N	probably damaging	Het
Dars2	G	A	1: 161,054,044	P305L	possibly damaging	Het
Ddx11	C	T	17: 66,150,697	T859I	probably benign	Het
Dock7	C	T	4: 98,962,196		probably null	Het
Doxl2	T	A	6: 48,975,171	L10Q	probably damaging	Het
Efcab6	A	G	15: 83,947,638	V570A	probably benign	Het
Fermt1	T	A	2: 132,922,831	I369F	probably damaging	Het
Fras1	C	A	5: 96,709,978	P2044T	possibly damaging	Het
Fras1	A	G	5: 96,713,990	Y2161C	probably damaging	Het
Hspg2	G	A	4: 137,518,971	S1020N	probably benign	Het
Kif21a	A	G	15: 90,942,175	S1360P	probably damaging	Het
Lrp3	T	C	7: 35,203,925	Y332C	probably damaging	Het
Ltc4s	C	A	11: 50,237,388	A32S	possibly damaging	Het
Mgrn1	T	C	16: 4,910,763	L84P	probably damaging	Het
Muc2	C	G	7: 141,697,162	C672W	probably damaging	Het
Mvp	A	T	7: 127,001,673	V52E	probably damaging	Het
Ndrg2	T	C	14: 51,906,963	T269A	probably damaging	Het
Notch2	T	A	3: 98,111,575	D684E	probably damaging	Het
Nup205	A	G	6: 35,191,943	D316G	probably benign	Het
Olfr1126	T	A	2: 87,457,672	I169K	probably damaging	Het
Olfr1396	T	C	11: 49,113,244	M161V	probably benign	Het
Olfr867	A	G	9: 20,055,382	L27P	probably damaging	Het
Pcsk1	A	T	13: 75,126,852	D520V	probably benign	Het
Pik3cg	A	T	12: 32,194,742	D904E	probably damaging	Het
Pitpnm2	T	A	5: 124,133,433	D359V	probably benign	Het
Ppih	T	C	4: 119,318,582	I69V	probably damaging	Het
Rab11fip3	T	C	17: 26,068,891	E96G	possibly damaging	Het
Retreg3	C	A	11: 101,102,049	M1I	probably null	Het
Rfpl4	C	T	7: 5,115,410	V54I	possibly damaging	Het
Rif1	T	C	2: 52,103,640	I855T	probably benign	Het
Rrm1	T	A	7: 102,468,347	I748N	probably damaging	Het
Sap130	T	A	18: 31,674,464	N441K	probably damaging	Het
Sf3b1	T	A	1: 55,019,377	I18F	probably damaging	Het
Skor2	A	G	18: 76,858,804	N74D	unknown	Het
Slc17a6	C	A	7: 51,661,460	F307L	probably benign	Het
Slc25a13	G	A	6: 6,096,675	L410F	probably damaging	Het
Slc47a1	A	T	11: 61,371,799	V38E	probably damaging	Het
Slc8a1	T	A	17: 81,649,241	T123S	probably damaging	Het
Slc9a5	C	A	8: 105,368,123	T782K	possibly damaging	Het
Spata48	C	A	11: 11,488,644		probably benign	Het
Sppl2c	C	A	11: 104,187,169	T265K	probably damaging	Het
Srfbp1	A	G	18: 52,488,716	K283R	probably benign	Het
Ssr1	C	T	13: 37,989,503		probably null	Het
Stard3nl	T	C	13: 19,372,584		probably null	Het
Timeless	G	T	10: 128,240,624	S134I	probably damaging	Het
Tll1	A	G	8: 64,041,442	F760L	probably damaging	Het
Tspear	A	G	10: 77,870,499	I368V	probably benign	Het
Txnrd2	G	T	16: 18,438,366	W144L	probably damaging	Het
Unc5d	T	C	8: 28,683,206	E668G	probably damaging	Het
Urb1	C	T	16: 90,774,048		probably null	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vmn1r66	G	T	7: 10,274,389	T239K	probably benign	Het
Vps39	C	T	2: 120,323,625	V630M	probably damaging	Het
Wrn	T	C	8: 33,329,130	T22A	probably benign	Het
Zfp7	T	A	15: 76,881,174	D22E	probably damaging	Het

Other mutations in Gucy1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00951:Gucy1a1	APN	3	82111191	missense	probably benign	0.00
IGL01626:Gucy1a1	APN	3	82108619	missense	probably damaging	1.00
IGL01662:Gucy1a1	APN	3	82109253	missense	possibly damaging	0.63
IGL02480:Gucy1a1	APN	3	82097733	missense	probably damaging	1.00
IGL02902:Gucy1a1	APN	3	82118917	missense	possibly damaging	0.87
IGL03022:Gucy1a1	APN	3	82109097	missense	probably benign	0.30
IGL03056:Gucy1a1	APN	3	82113287	missense	probably benign	0.00
IGL03089:Gucy1a1	APN	3	82097681	missense	probably damaging	1.00
IGL03226:Gucy1a1	APN	3	82119024	missense	probably benign	0.00
IGL03377:Gucy1a1	APN	3	82106015	missense	probably damaging	1.00
R0245:Gucy1a1	UTSW	3	82108787	missense	possibly damaging	0.67
R0762:Gucy1a1	UTSW	3	82094896	missense	unknown
R0907:Gucy1a1	UTSW	3	82111191	missense	probably benign	0.00
R1242:Gucy1a1	UTSW	3	82105953	splice site	probably null
R1671:Gucy1a1	UTSW	3	82106222	missense	probably damaging	1.00
R2056:Gucy1a1	UTSW	3	82109285	missense	possibly damaging	0.89
R2094:Gucy1a1	UTSW	3	82113332	missense	probably benign
R2140:Gucy1a1	UTSW	3	82118886	splice site	probably null
R2154:Gucy1a1	UTSW	3	82111151	critical splice donor site	probably null
R3418:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R3419:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R4290:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4291:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4292:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4294:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4573:Gucy1a1	UTSW	3	82108922	missense	possibly damaging	0.95
R4629:Gucy1a1	UTSW	3	82097624	missense	probably damaging	1.00
R4755:Gucy1a1	UTSW	3	82094795	missense	probably benign	0.40
R4865:Gucy1a1	UTSW	3	82119162	utr 5 prime	probably benign
R5528:Gucy1a1	UTSW	3	82109073	missense	probably damaging	1.00
R5933:Gucy1a1	UTSW	3	82094807	missense	probably damaging	0.96
R6278:Gucy1a1	UTSW	3	82097634	missense	probably damaging	1.00
R6385:Gucy1a1	UTSW	3	82109006	missense	probably benign
R7011:Gucy1a1	UTSW	3	82109115	missense	probably damaging	1.00
R7361:Gucy1a1	UTSW	3	82097720	missense	probably damaging	1.00
R7648:Gucy1a1	UTSW	3	82108707	missense	possibly damaging	0.63
R7709:Gucy1a1	UTSW	3	82094789	missense	unknown
R7770:Gucy1a1	UTSW	3	82108805	missense	possibly damaging	0.95
R8443:Gucy1a1	UTSW	3	82097693	missense	probably damaging	1.00
R8531:Gucy1a1	UTSW	3	82111161	missense	probably benign
R8872:Gucy1a1	UTSW	3	82108742	missense	probably damaging	0.99
R9055:Gucy1a1	UTSW	3	82109126	missense	possibly damaging	0.73
R9168:Gucy1a1	UTSW	3	82102046	missense	probably damaging	0.97
R9231:Gucy1a1	UTSW	3	82106001	missense	probably damaging	1.00
R9316:Gucy1a1	UTSW	3	82108943	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CTCCCGTTTAGGCAGTACAATCCC -3'
(R):5'- GAGTTGCTCTGACACCTCCACTTAC -3'

Sequencing Primer
(F):5'- ggggagtgtgtgacacag -3'
(R):5'- GACACCTCCACTTACCCTGC -3'

Posted On

2014-04-24