Mutagenetix > Incidental Mutation

Incidental Mutation 'R1625:Casp8ap2'

174948

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

039662-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32648068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1925 (M1925K)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

probably benign
Transcript: ENSMUST00000029950
AA Change: M1925K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: M1925K

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178
AA Change: M153K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282
AA Change: M153K

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000178925
AA Change: M1925K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: M1925K

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,431,668	Y655H	probably damaging	Het
Abca8b	T	A	11: 109,967,121	M605L	probably benign	Het
Abcc5	A	T	16: 20,365,817	S1031T	probably damaging	Het
Acot7	T	A	4: 152,186,291	C31S	probably benign	Het
Acss3	A	T	10: 106,937,402		probably null	Het
Adipor1	T	C	1: 134,424,064	F83S	possibly damaging	Het
Agrn	G	A	4: 156,172,860	S1171L	probably damaging	Het
Arhgap5	T	A	12: 52,517,376	C377S	probably benign	Het
Arid4b	T	A	13: 14,187,114	V721D	probably damaging	Het
Aspm	G	A	1: 139,481,039	A2555T	probably benign	Het
Atp6v0a1	T	A	11: 101,055,554	L791Q	probably damaging	Het
Car11	A	G	7: 45,701,307	K76E	probably benign	Het
Cc2d1a	A	T	8: 84,139,372	L418Q	probably damaging	Het
Ccl9	G	A	11: 83,575,910	R64W	probably damaging	Het
Cfap43	T	A	19: 47,751,088	K1325N	probably damaging	Het
Dars2	G	A	1: 161,054,044	P305L	possibly damaging	Het
Ddx11	C	T	17: 66,150,697	T859I	probably benign	Het
Dock7	C	T	4: 98,962,196		probably null	Het
Doxl2	T	A	6: 48,975,171	L10Q	probably damaging	Het
Efcab6	A	G	15: 83,947,638	V570A	probably benign	Het
Fermt1	T	A	2: 132,922,831	I369F	probably damaging	Het
Fras1	C	A	5: 96,709,978	P2044T	possibly damaging	Het
Fras1	A	G	5: 96,713,990	Y2161C	probably damaging	Het
Gucy1a1	T	C	3: 82,102,055	I549V	probably benign	Het
Hspg2	G	A	4: 137,518,971	S1020N	probably benign	Het
Kif21a	A	G	15: 90,942,175	S1360P	probably damaging	Het
Lrp3	T	C	7: 35,203,925	Y332C	probably damaging	Het
Ltc4s	C	A	11: 50,237,388	A32S	possibly damaging	Het
Mgrn1	T	C	16: 4,910,763	L84P	probably damaging	Het
Muc2	C	G	7: 141,697,162	C672W	probably damaging	Het
Mvp	A	T	7: 127,001,673	V52E	probably damaging	Het
Ndrg2	T	C	14: 51,906,963	T269A	probably damaging	Het
Notch2	T	A	3: 98,111,575	D684E	probably damaging	Het
Nup205	A	G	6: 35,191,943	D316G	probably benign	Het
Olfr1126	T	A	2: 87,457,672	I169K	probably damaging	Het
Olfr1396	T	C	11: 49,113,244	M161V	probably benign	Het
Olfr867	A	G	9: 20,055,382	L27P	probably damaging	Het
Pcsk1	A	T	13: 75,126,852	D520V	probably benign	Het
Pik3cg	A	T	12: 32,194,742	D904E	probably damaging	Het
Pitpnm2	T	A	5: 124,133,433	D359V	probably benign	Het
Ppih	T	C	4: 119,318,582	I69V	probably damaging	Het
Rab11fip3	T	C	17: 26,068,891	E96G	possibly damaging	Het
Retreg3	C	A	11: 101,102,049	M1I	probably null	Het
Rfpl4	C	T	7: 5,115,410	V54I	possibly damaging	Het
Rif1	T	C	2: 52,103,640	I855T	probably benign	Het
Rrm1	T	A	7: 102,468,347	I748N	probably damaging	Het
Sap130	T	A	18: 31,674,464	N441K	probably damaging	Het
Sf3b1	T	A	1: 55,019,377	I18F	probably damaging	Het
Skor2	A	G	18: 76,858,804	N74D	unknown	Het
Slc17a6	C	A	7: 51,661,460	F307L	probably benign	Het
Slc25a13	G	A	6: 6,096,675	L410F	probably damaging	Het
Slc47a1	A	T	11: 61,371,799	V38E	probably damaging	Het
Slc8a1	T	A	17: 81,649,241	T123S	probably damaging	Het
Slc9a5	C	A	8: 105,368,123	T782K	possibly damaging	Het
Spata48	C	A	11: 11,488,644		probably benign	Het
Sppl2c	C	A	11: 104,187,169	T265K	probably damaging	Het
Srfbp1	A	G	18: 52,488,716	K283R	probably benign	Het
Ssr1	C	T	13: 37,989,503		probably null	Het
Stard3nl	T	C	13: 19,372,584		probably null	Het
Timeless	G	T	10: 128,240,624	S134I	probably damaging	Het
Tll1	A	G	8: 64,041,442	F760L	probably damaging	Het
Tspear	A	G	10: 77,870,499	I368V	probably benign	Het
Txnrd2	G	T	16: 18,438,366	W144L	probably damaging	Het
Unc5d	T	C	8: 28,683,206	E668G	probably damaging	Het
Urb1	C	T	16: 90,774,048		probably null	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vmn1r66	G	T	7: 10,274,389	T239K	probably benign	Het
Vps39	C	T	2: 120,323,625	V630M	probably damaging	Het
Wrn	T	C	8: 33,329,130	T22A	probably benign	Het
Zfp7	T	A	15: 76,881,174	D22E	probably damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32645873	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32643924	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32643807	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGTTCCCTGTCACAGTCACCGA -3'
(R):5'- TGCCTCTGGGTTTAATCTCCAGCAT -3'

Sequencing Primer
(F):5'- GACCTAGCTTGTTTCTTGACTAGAAC -3'
(R):5'- GTACAAAGCTGGGTAATTACCTG -3'

Posted On

2014-04-24