Incidental Mutation 'R1625:Dock7'
ID174949
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1625 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 98962196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127417] [ENSMUST00000205650] [ENSMUST00000205650] [ENSMUST00000205652]
Predicted Effect probably null
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect probably null
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140848
Predicted Effect probably null
Transcript: ENSMUST00000205650
Predicted Effect probably null
Transcript: ENSMUST00000205650
Predicted Effect probably benign
Transcript: ENSMUST00000205652
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Adipor1 T C 1: 134,424,064 F83S possibly damaging Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Hspg2 G A 4: 137,518,971 S1020N probably benign Het
Kif21a A G 15: 90,942,175 S1360P probably damaging Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Rab11fip3 T C 17: 26,068,891 E96G possibly damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Sppl2c C A 11: 104,187,169 T265K probably damaging Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
R7928:Dock7 UTSW 4 99001098 missense
R7984:Dock7 UTSW 4 98989066 missense unknown
R8287:Dock7 UTSW 4 98977920 missense unknown
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGAACTGCCTACATCTACTGCTAC -3'
(R):5'- TTTGCCAGAGTGAAAATGCAAGTGAC -3'

Sequencing Primer
(F):5'- agcaaaaacaggaggcaaag -3'
(R):5'- GTGACGATGTCACTGTCCTC -3'
Posted On2014-04-24