Incidental Mutation 'R1625:Sppl2c'
ID174988
Institutional Source Beutler Lab
Gene Symbol Sppl2c
Ensembl Gene ENSMUSG00000049506
Gene Namesignal peptide peptidase 2C
Synonyms
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1625 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location104186327-104191163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104187169 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 265 (T265K)
Ref Sequence ENSEMBL: ENSMUSP00000102613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059448] [ENSMUST00000107000]
Predicted Effect probably damaging
Transcript: ENSMUST00000059448
AA Change: T265K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091453
Gene: ENSMUSG00000049506
AA Change: T265K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 1.8e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107000
AA Change: T265K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102613
Gene: ENSMUSG00000049506
AA Change: T265K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 2.3e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Adipor1 T C 1: 134,424,064 F83S possibly damaging Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Dock7 C T 4: 98,962,196 probably null Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Hspg2 G A 4: 137,518,971 S1020N probably benign Het
Kif21a A G 15: 90,942,175 S1360P probably damaging Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Rab11fip3 T C 17: 26,068,891 E96G possibly damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Sppl2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Sppl2c APN 11 104186979 missense possibly damaging 0.83
IGL02326:Sppl2c APN 11 104187273 missense probably benign 0.27
IGL02479:Sppl2c APN 11 104186937 missense probably benign
H8786:Sppl2c UTSW 11 104186865 missense probably benign 0.04
R0083:Sppl2c UTSW 11 104186532 missense probably benign 0.00
R1913:Sppl2c UTSW 11 104187889 missense probably benign 0.15
R2037:Sppl2c UTSW 11 104186481 missense probably benign 0.23
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2873:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3009:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3010:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3011:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R4698:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4718:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4841:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R4842:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R5248:Sppl2c UTSW 11 104186581 missense possibly damaging 0.88
R5288:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5300:Sppl2c UTSW 11 104187075 missense possibly damaging 0.52
R5384:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5386:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5427:Sppl2c UTSW 11 104187867 missense probably benign 0.01
R5452:Sppl2c UTSW 11 104187300 missense probably benign
R5796:Sppl2c UTSW 11 104187793 missense probably benign 0.00
R6112:Sppl2c UTSW 11 104187137 missense probably benign 0.00
R6452:Sppl2c UTSW 11 104188191 missense probably benign 0.01
R6476:Sppl2c UTSW 11 104186769 missense probably benign
R7368:Sppl2c UTSW 11 104187604 missense probably damaging 0.99
R7896:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
R7954:Sppl2c UTSW 11 104188516 utr 3 prime probably null
R7979:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
R8035:Sppl2c UTSW 11 104187366
Predicted Primers PCR Primer
(F):5'- TCCGAGTAGCCATGTTTGCACC -3'
(R):5'- GCCATGTTACAGAAACCCGTTGTCC -3'

Sequencing Primer
(F):5'- CCTGTTACTGACTATAACATGGCG -3'
(R):5'- AACCCGTTGTCCAGGCAAG -3'
Posted On2014-04-24