Incidental Mutation 'R1625:Kif21a'
ID175003
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1625 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90942175 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1360 (S1360P)
Ref Sequence ENSEMBL: ENSMUSP00000066911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
Predicted Effect probably damaging
Transcript: ENSMUST00000067205
AA Change: S1360P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: S1360P

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088614
AA Change: S1404P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: S1404P

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100304
AA Change: S1404P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: S1404P

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
AA Change: S1299P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: S1299P

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109288
AA Change: S1305P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: S1305P

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Predicted Effect unknown
Transcript: ENSMUST00000230487
AA Change: S106P
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Adipor1 T C 1: 134,424,064 F83S possibly damaging Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Dock7 C T 4: 98,962,196 probably null Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Hspg2 G A 4: 137,518,971 S1020N probably benign Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Rab11fip3 T C 17: 26,068,891 E96G possibly damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Sppl2c C A 11: 104,187,169 T265K probably damaging Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAGGCAGTGTGTCCATCCTAAAAC -3'
(R):5'- GGTCATGCCCAGTTCAGGAAAATCG -3'

Sequencing Primer
(F):5'- GTGTCCATCCTAAAACATGCTTGG -3'
(R):5'- ATCGGGAAGTACCATCATCCTTTG -3'
Posted On2014-04-24