Mutagenetix > Incidental Mutations

Incidental Mutation 'R1625:Urb1'

175008

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

039662-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 90774048 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140158

Predicted Effect

probably null
Transcript: ENSMUST00000140920

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,431,668	Y655H	probably damaging	Het
Abca8b	T	A	11: 109,967,121	M605L	probably benign	Het
Abcc5	A	T	16: 20,365,817	S1031T	probably damaging	Het
Acot7	T	A	4: 152,186,291	C31S	probably benign	Het
Acss3	A	T	10: 106,937,402		probably null	Het
Adipor1	T	C	1: 134,424,064	F83S	possibly damaging	Het
Agrn	G	A	4: 156,172,860	S1171L	probably damaging	Het
Arhgap5	T	A	12: 52,517,376	C377S	probably benign	Het
Arid4b	T	A	13: 14,187,114	V721D	probably damaging	Het
Aspm	G	A	1: 139,481,039	A2555T	probably benign	Het
Atp6v0a1	T	A	11: 101,055,554	L791Q	probably damaging	Het
Car11	A	G	7: 45,701,307	K76E	probably benign	Het
Casp8ap2	T	A	4: 32,648,068	M1925K	probably benign	Het
Cc2d1a	A	T	8: 84,139,372	L418Q	probably damaging	Het
Ccl9	G	A	11: 83,575,910	R64W	probably damaging	Het
Cfap43	T	A	19: 47,751,088	K1325N	probably damaging	Het
Dars2	G	A	1: 161,054,044	P305L	possibly damaging	Het
Ddx11	C	T	17: 66,150,697	T859I	probably benign	Het
Dock7	C	T	4: 98,962,196		probably null	Het
Doxl2	T	A	6: 48,975,171	L10Q	probably damaging	Het
Efcab6	A	G	15: 83,947,638	V570A	probably benign	Het
Fermt1	T	A	2: 132,922,831	I369F	probably damaging	Het
Fras1	C	A	5: 96,709,978	P2044T	possibly damaging	Het
Fras1	A	G	5: 96,713,990	Y2161C	probably damaging	Het
Gucy1a1	T	C	3: 82,102,055	I549V	probably benign	Het
Hspg2	G	A	4: 137,518,971	S1020N	probably benign	Het
Kif21a	A	G	15: 90,942,175	S1360P	probably damaging	Het
Lrp3	T	C	7: 35,203,925	Y332C	probably damaging	Het
Ltc4s	C	A	11: 50,237,388	A32S	possibly damaging	Het
Mgrn1	T	C	16: 4,910,763	L84P	probably damaging	Het
Muc2	C	G	7: 141,697,162	C672W	probably damaging	Het
Mvp	A	T	7: 127,001,673	V52E	probably damaging	Het
Ndrg2	T	C	14: 51,906,963	T269A	probably damaging	Het
Notch2	T	A	3: 98,111,575	D684E	probably damaging	Het
Nup205	A	G	6: 35,191,943	D316G	probably benign	Het
Olfr1126	T	A	2: 87,457,672	I169K	probably damaging	Het
Olfr1396	T	C	11: 49,113,244	M161V	probably benign	Het
Olfr867	A	G	9: 20,055,382	L27P	probably damaging	Het
Pcsk1	A	T	13: 75,126,852	D520V	probably benign	Het
Pik3cg	A	T	12: 32,194,742	D904E	probably damaging	Het
Pitpnm2	T	A	5: 124,133,433	D359V	probably benign	Het
Ppih	T	C	4: 119,318,582	I69V	probably damaging	Het
Rab11fip3	T	C	17: 26,068,891	E96G	possibly damaging	Het
Retreg3	C	A	11: 101,102,049	M1I	probably null	Het
Rfpl4	C	T	7: 5,115,410	V54I	possibly damaging	Het
Rif1	T	C	2: 52,103,640	I855T	probably benign	Het
Rrm1	T	A	7: 102,468,347	I748N	probably damaging	Het
Sap130	T	A	18: 31,674,464	N441K	probably damaging	Het
Sf3b1	T	A	1: 55,019,377	I18F	probably damaging	Het
Skor2	A	G	18: 76,858,804	N74D	unknown	Het
Slc17a6	C	A	7: 51,661,460	F307L	probably benign	Het
Slc25a13	G	A	6: 6,096,675	L410F	probably damaging	Het
Slc47a1	A	T	11: 61,371,799	V38E	probably damaging	Het
Slc8a1	T	A	17: 81,649,241	T123S	probably damaging	Het
Slc9a5	C	A	8: 105,368,123	T782K	possibly damaging	Het
Spata48	C	A	11: 11,488,644		probably benign	Het
Sppl2c	C	A	11: 104,187,169	T265K	probably damaging	Het
Srfbp1	A	G	18: 52,488,716	K283R	probably benign	Het
Ssr1	C	T	13: 37,989,503		probably null	Het
Stard3nl	T	C	13: 19,372,584		probably null	Het
Timeless	G	T	10: 128,240,624	S134I	probably damaging	Het
Tll1	A	G	8: 64,041,442	F760L	probably damaging	Het
Tspear	A	G	10: 77,870,499	I368V	probably benign	Het
Txnrd2	G	T	16: 18,438,366	W144L	probably damaging	Het
Unc5d	T	C	8: 28,683,206	E668G	probably damaging	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vmn1r66	G	T	7: 10,274,389	T239K	probably benign	Het
Vps39	C	T	2: 120,323,625	V630M	probably damaging	Het
Wrn	T	C	8: 33,329,130	T22A	probably benign	Het
Zfp7	T	A	15: 76,881,174	D22E	probably damaging	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGCCCAGACTCAGTATGAACTCACC -3'
(R):5'- GCTGGACACGGTATTCCTTCAGAC -3'

Sequencing Primer
(F):5'- CTTACTTCCTAAGGTCAAGAGACAGG -3'
(R):5'- TTCAGAAAGACCCCGTGCTG -3'

Posted On

2014-04-24