Incidental Mutation 'R1625:Rab11fip3'
ID175009
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1625 (G1)
Quality Score205
Status Not validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26068891 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120691
AA Change: E96G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: E96G

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122103
AA Change: E96G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: E96G

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126306
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Adipor1 T C 1: 134,424,064 F83S possibly damaging Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Dock7 C T 4: 98,962,196 probably null Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Hspg2 G A 4: 137,518,971 S1020N probably benign Het
Kif21a A G 15: 90,942,175 S1360P probably damaging Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Sppl2c C A 11: 104,187,169 T265K probably damaging Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense probably damaging 0.97
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26069054 missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26068178 missense probably benign
R2382:Rab11fip3 UTSW 17 25990867 nonsense probably null
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26016064 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26016116 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26068152 missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26068874 missense possibly damaging 0.66
R7836:Rab11fip3 UTSW 17 26068258 missense possibly damaging 0.82
R7981:Rab11fip3 UTSW 17 25997989 missense probably damaging 0.98
R8008:Rab11fip3 UTSW 17 26067982 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGTGACAGAATGCGTCTGGTTCCT -3'
(R):5'- GAACACGCCCAGCTTCAACGGT -3'

Sequencing Primer
(F):5'- GGGTTCCTCTAGCTCCTTGG -3'
(R):5'- TAGTCGCTGGGCCAAAGA -3'
Posted On2014-04-24