Incidental Mutation 'R1228:Ccdc181'
ID175022
Institutional Source Beutler Lab
Gene Symbol Ccdc181
Ensembl Gene ENSMUSG00000026578
Gene Namecoiled-coil domain containing 181
Synonyms4930455F23Rik
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1228 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164275585-164287847 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 164286391 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 455 (R455*)
Ref Sequence ENSEMBL: ENSMUSP00000027867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027866] [ENSMUST00000027867] [ENSMUST00000120447]
Predicted Effect probably benign
Transcript: ENSMUST00000027866
SMART Domains Protein: ENSMUSP00000027866
Gene: ENSMUSG00000026577

DomainStartEndE-ValueType
coiled coil region 130 175 N/A INTRINSIC
Pfam:DASH_Hsk3 191 236 2.9e-13 PFAM
coiled coil region 243 276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000027867
AA Change: R455*
SMART Domains Protein: ENSMUSP00000027867
Gene: ENSMUSG00000026578
AA Change: R455*

DomainStartEndE-ValueType
low complexity region 116 122 N/A INTRINSIC
coiled coil region 334 378 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120447
SMART Domains Protein: ENSMUSP00000113479
Gene: ENSMUSG00000026577

DomainStartEndE-ValueType
coiled coil region 123 168 N/A INTRINSIC
Pfam:DASH_Hsk3 184 230 2.6e-18 PFAM
coiled coil region 236 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Ccdc181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ccdc181 APN 1 164280144 missense possibly damaging 0.75
IGL02634:Ccdc181 APN 1 164279945 missense probably benign 0.00
IGL02902:Ccdc181 APN 1 164279901 missense probably benign
IGL03201:Ccdc181 APN 1 164280644 missense probably benign 0.13
R1371:Ccdc181 UTSW 1 164280603 missense probably benign 0.34
R1819:Ccdc181 UTSW 1 164282478 nonsense probably null
R2240:Ccdc181 UTSW 1 164280027 missense probably damaging 1.00
R3160:Ccdc181 UTSW 1 164280296 missense probably damaging 0.97
R3162:Ccdc181 UTSW 1 164280296 missense probably damaging 0.97
R4678:Ccdc181 UTSW 1 164278277 missense probably damaging 1.00
R5286:Ccdc181 UTSW 1 164278241 missense probably damaging 1.00
R6179:Ccdc181 UTSW 1 164279918 missense probably benign 0.21
R6886:Ccdc181 UTSW 1 164280096 missense probably damaging 0.96
R7517:Ccdc181 UTSW 1 164280420 missense probably damaging 1.00
R7528:Ccdc181 UTSW 1 164279958 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTTGAGCACGCCCATC -3'
(R):5'- AGGAAGTTCACACAAATGGAATCAACCT -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctctc -3'
(R):5'- ATGGAATCAACCTTTATTCTCCAACC -3'
Posted On2014-04-24