Incidental Mutation 'R1228:Akap2'
ID175025
Institutional Source Beutler Lab
Gene Symbol Akap2
Ensembl Gene ENSMUSG00000038729
Gene NameA kinase (PRKA) anchor protein 2
SynonymsAKAP-KL, B230340M18Rik
MMRRC Submission 039297-MU
Accession Numbers

Genbank: NM_001035533; MGI: 1306795

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1228 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location57717657-57896984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57856909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 787 (I787N)
Ref Sequence ENSEMBL: ENSMUSP00000103226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043456] [ENSMUST00000098064] [ENSMUST00000098066] [ENSMUST00000102902] [ENSMUST00000102903] [ENSMUST00000107598] [ENSMUST00000107600] [ENSMUST00000124581] [ENSMUST00000126465] [ENSMUST00000132497]
Predicted Effect probably damaging
Transcript: ENSMUST00000043456
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048678
Gene: ENSMUSG00000038729
AA Change: I746N

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 568 885 2.5e-17 PFAM
Pfam:RII_binding_1 585 602 1.6e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098064
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095672
Gene: ENSMUSG00000038729
AA Change: I746N

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098065
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102902
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099966
Gene: ENSMUSG00000038729
AA Change: I746N

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102903
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099967
Gene: ENSMUSG00000038729
AA Change: I746N

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107598
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103224
Gene: ENSMUSG00000038729
AA Change: I746N

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107600
AA Change: I787N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103226
Gene: ENSMUSG00000038729
AA Change: I787N

DomainStartEndE-ValueType
low complexity region 193 204 N/A INTRINSIC
low complexity region 254 268 N/A INTRINSIC
coiled coil region 297 355 N/A INTRINSIC
Pfam:AKAP2_C 636 913 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124581
SMART Domains Protein: ENSMUSP00000119742
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132497
Predicted Effect unknown
Transcript: ENSMUST00000150412
AA Change: I989N
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945
AA Change: I989N

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the regulatory subunit of protein kinase A and is found associated with the actin cytoskeleton. The encoded protein mediates signals carried by cAMP and may be involved in creating polarity in certain signaling processes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Akap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
A9681:Akap2 UTSW 4 57855358 missense probably damaging 1.00
IGL02835:Akap2 UTSW 4 57883044 missense probably damaging 1.00
R0284:Akap2 UTSW 4 57855207 missense probably damaging 1.00
R0356:Akap2 UTSW 4 57855628 missense possibly damaging 0.48
R0594:Akap2 UTSW 4 57856752 missense probably benign 0.00
R0614:Akap2 UTSW 4 57856720 missense probably benign 0.41
R0617:Akap2 UTSW 4 57829434 intron probably benign
R2081:Akap2 UTSW 4 57855927 missense possibly damaging 0.49
R2128:Akap2 UTSW 4 57854890 missense probably benign 0.40
R4667:Akap2 UTSW 4 57855655 missense possibly damaging 0.80
R4804:Akap2 UTSW 4 57854688 missense probably benign 0.05
R4989:Akap2 UTSW 4 57856552 missense probably benign
R5135:Akap2 UTSW 4 57855912 missense probably benign 0.00
R5292:Akap2 UTSW 4 57855356 missense probably damaging 0.98
R5420:Akap2 UTSW 4 57856062 missense probably benign 0.08
R5420:Akap2 UTSW 4 57856434 missense probably damaging 1.00
R5517:Akap2 UTSW 4 57855987 missense probably damaging 0.99
R5648:Akap2 UTSW 4 57854848 missense probably damaging 1.00
R5886:Akap2 UTSW 4 57856295 missense probably damaging 1.00
R5993:Akap2 UTSW 4 57855273 missense possibly damaging 0.86
R6133:Akap2 UTSW 4 57855516 nonsense probably null
R6189:Akap2 UTSW 4 57855928 missense probably benign 0.00
R6221:Akap2 UTSW 4 57855618 nonsense probably null
R6532:Akap2 UTSW 4 57855174 missense probably benign 0.00
R6760:Akap2 UTSW 4 57856026 missense probably damaging 1.00
R6792:Akap2 UTSW 4 57855880 missense possibly damaging 0.90
R7128:Akap2 UTSW 4 57855816 missense probably benign 0.03
R7269:Akap2 UTSW 4 57855217 missense probably damaging 1.00
R7837:Akap2 UTSW 4 57855262 missense probably damaging 1.00
R8094:Akap2 UTSW 4 57886319 missense possibly damaging 0.81
R8275:Akap2 UTSW 4 57886329 critical splice donor site probably null
Z1177:Akap2 UTSW 4 57856348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGTCAACATGGAAGAGACCAG -3'
(R):5'- AGGAGCCCTCATATCCACTGAGAAC -3'

Sequencing Primer
(F):5'- AGCAAGTATTCAGAGGCAGC -3'
(R):5'- TGAACGGAGTCACTTTCCCAG -3'
Posted On2014-04-24