Incidental Mutation 'R1228:Rpia'
ID175030
Institutional Source Beutler Lab
Gene Symbol Rpia
Ensembl Gene ENSMUSG00000053604
Gene Nameribose 5-phosphate isomerase A
Synonyms
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1228 (G1)
Quality Score90
Status Not validated
Chromosome6
Chromosomal Location70765720-70792232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70791896 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 85 (N85S)
Ref Sequence ENSEMBL: ENSMUSP00000064158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066134]
Predicted Effect probably benign
Transcript: ENSMUST00000066134
AA Change: N85S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064158
Gene: ENSMUSG00000053604
AA Change: N85S

DomainStartEndE-ValueType
low complexity region 16 38 N/A INTRINSIC
low complexity region 56 66 N/A INTRINSIC
Pfam:Rib_5-P_isom_A 120 294 7.3e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129244
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme, which catalyzes the reversible conversion between ribose-5-phosphate and ribulose-5-phosphate in the pentose-phosphate pathway. This gene is highly conserved in most organisms. The enzyme plays an essential role in the carbohydrate metabolism. Mutations in this gene cause ribose 5-phosphate isomerase deficiency. A pseudogene is found on chromosome 18. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Rpia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Rpia APN 6 70775102 splice site probably benign
R4629:Rpia UTSW 6 70766594 missense possibly damaging 0.46
R5249:Rpia UTSW 6 70783579 nonsense probably null
R6302:Rpia UTSW 6 70773501 missense probably damaging 0.96
R6772:Rpia UTSW 6 70785548 missense probably benign 0.08
R6932:Rpia UTSW 6 70773440 missense probably benign 0.00
R7718:Rpia UTSW 6 70766618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGTTGACACCCACCCATTCG -3'
(R):5'- TCGCCGTAGGACTACATTTCCCAG -3'

Sequencing Primer
(F):5'- ACCCATTCGGGGTCTAGAAG -3'
(R):5'- TTTCCCAGCAACACGCATTTAG -3'
Posted On2014-04-24