Incidental Mutation 'R1228:Rabac1'
ID175031
Institutional Source Beutler Lab
Gene Symbol Rabac1
Ensembl Gene ENSMUSG00000003380
Gene NameRab acceptor 1 (prenylated)
SynonymsGbpap1, PRA1, prenylin, 2310040I06Rik
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1228 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24969752-24972754 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 24972098 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076961] [ENSMUST00000205871]
Predicted Effect probably null
Transcript: ENSMUST00000076961
SMART Domains Protein: ENSMUSP00000076227
Gene: ENSMUSG00000003380

DomainStartEndE-ValueType
Pfam:PRA1 37 177 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205771
Predicted Effect probably null
Transcript: ENSMUST00000205871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206941
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Rabac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Rabac1 UTSW 7 24970182 missense probably damaging 1.00
R1511:Rabac1 UTSW 7 24972130 missense probably damaging 1.00
R4515:Rabac1 UTSW 7 24970160 nonsense probably null
R4878:Rabac1 UTSW 7 24969967 missense possibly damaging 0.56
V7732:Rabac1 UTSW 7 24972219 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGAAGTTTGCATTCCGTGAGACC -3'
(R):5'- TGCTGCCCAAGCTGATTCCATC -3'

Sequencing Primer
(F):5'- CTCTAGCTTTGGACACAGACTGAG -3'
(R):5'- AAGCTGATTCCATCCGGCG -3'
Posted On2014-04-24