Incidental Mutation 'R1228:Klhl25'
ID175032
Institutional Source Beutler Lab
Gene Symbol Klhl25
Ensembl Gene ENSMUSG00000055652
Gene Namekelch-like 25
Synonyms
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1228 (G1)
Quality Score184
Status Not validated
Chromosome7
Chromosomal Location75848310-75874131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75866120 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 258 (A258V)
Ref Sequence ENSEMBL: ENSMUSP00000146102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092073] [ENSMUST00000171155] [ENSMUST00000205612] [ENSMUST00000205887] [ENSMUST00000206019]
Predicted Effect probably benign
Transcript: ENSMUST00000092073
AA Change: A258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089707
Gene: ENSMUSG00000055652
AA Change: A258V

DomainStartEndE-ValueType
BTB 46 144 2.43e-28 SMART
BACK 149 251 1.06e-32 SMART
Blast:BTB 256 294 1e-9 BLAST
Kelch 296 340 1.4e0 SMART
Kelch 341 388 6.71e-10 SMART
Kelch 389 444 2.25e-11 SMART
Kelch 445 492 1.22e-1 SMART
Kelch 493 538 1.92e-5 SMART
Kelch 539 585 1.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171155
AA Change: A258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133175
Gene: ENSMUSG00000055652
AA Change: A258V

DomainStartEndE-ValueType
BTB 46 144 2.43e-28 SMART
BACK 149 251 1.06e-32 SMART
Blast:BTB 256 294 1e-9 BLAST
Kelch 296 340 1.4e0 SMART
Kelch 341 388 6.71e-10 SMART
Kelch 389 444 2.25e-11 SMART
Kelch 445 492 1.22e-1 SMART
Kelch 493 538 1.92e-5 SMART
Kelch 539 585 1.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205612
Predicted Effect probably benign
Transcript: ENSMUST00000205887
Predicted Effect probably benign
Transcript: ENSMUST00000206019
AA Change: A258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206418
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Klhl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klhl25 APN 7 75866149 nonsense probably null
IGL01142:Klhl25 APN 7 75866596 missense probably damaging 1.00
IGL01295:Klhl25 APN 7 75865872 missense probably benign 0.20
IGL02272:Klhl25 APN 7 75866620 missense probably benign
IGL02721:Klhl25 APN 7 75866900 missense probably damaging 1.00
R0196:Klhl25 UTSW 7 75865702 missense probably damaging 1.00
R0365:Klhl25 UTSW 7 75866516 missense probably damaging 1.00
R0828:Klhl25 UTSW 7 75866195 missense probably damaging 0.99
R0881:Klhl25 UTSW 7 75866279 missense probably damaging 1.00
R1061:Klhl25 UTSW 7 75866520 nonsense probably null
R1696:Klhl25 UTSW 7 75866843 missense probably damaging 1.00
R1991:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R2118:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R4359:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R4428:Klhl25 UTSW 7 75865414 missense probably damaging 0.97
R4431:Klhl25 UTSW 7 75865414 missense probably damaging 0.97
R4717:Klhl25 UTSW 7 75866780 missense probably damaging 1.00
R4860:Klhl25 UTSW 7 75867050 missense probably benign 0.03
R4860:Klhl25 UTSW 7 75867050 missense probably benign 0.03
R5619:Klhl25 UTSW 7 75866854 missense probably benign 0.22
R5637:Klhl25 UTSW 7 75865792 intron probably null
R5652:Klhl25 UTSW 7 75866147 missense probably benign 0.06
R5840:Klhl25 UTSW 7 75866692 missense possibly damaging 0.92
R6693:Klhl25 UTSW 7 75866813 missense possibly damaging 0.91
R6723:Klhl25 UTSW 7 75865991 missense possibly damaging 0.64
R6875:Klhl25 UTSW 7 75866342 missense probably damaging 1.00
R7239:Klhl25 UTSW 7 75866768 missense probably benign 0.25
Z1177:Klhl25 UTSW 7 75866122 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACGAGTTCTCATGCCGAATGTCC -3'
(R):5'- GCAACCAATCGCTGAAGCACTG -3'

Sequencing Primer
(F):5'- GTTGGACCTCATCTCCAGAG -3'
(R):5'- TGAAGCACTGAACTCCTTCCG -3'
Posted On2014-04-24