Incidental Mutation 'R1228:Sh3gl3'
ID175033
Institutional Source Beutler Lab
Gene Symbol Sh3gl3
Ensembl Gene ENSMUSG00000030638
Gene NameSH3-domain GRB2-like 3
SynonymsEEN-B2, SH3P13, endophilin III, Sh3d2c, Sh3d2c2
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1228 (G1)
Quality Score200
Status Not validated
Chromosome7
Chromosomal Location82173840-82307419 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 82174975 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000032874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032874] [ENSMUST00000177883] [ENSMUST00000177895] [ENSMUST00000179318]
Predicted Effect probably null
Transcript: ENSMUST00000032874
AA Change: M1V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032874
Gene: ENSMUSG00000030638
AA Change: M1V

DomainStartEndE-ValueType
BAR 5 242 2.43e-89 SMART
SH3 288 343 5.77e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177883
AA Change: M1V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137207
Gene: ENSMUSG00000030638
AA Change: M1V

DomainStartEndE-ValueType
Pfam:BAR 6 65 2.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177895
AA Change: M1V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137570
Gene: ENSMUSG00000030638
AA Change: M1V

DomainStartEndE-ValueType
Pfam:BAR 6 65 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179150
Predicted Effect probably benign
Transcript: ENSMUST00000179318
SMART Domains Protein: ENSMUSP00000137621
Gene: ENSMUSG00000030638

DomainStartEndE-ValueType
BAR 1 207 1.23e-58 SMART
SH3 253 308 5.77e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180183
SMART Domains Protein: ENSMUSP00000136482
Gene: ENSMUSG00000030638

DomainStartEndE-ValueType
Pfam:BAR 1 153 3.8e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208082
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are normal and fertile. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmission and abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Sh3gl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Sh3gl3 APN 7 82285018 splice site probably benign
IGL02989:Sh3gl3 APN 7 82273879 missense probably benign 0.01
R1801:Sh3gl3 UTSW 7 82284119 missense possibly damaging 0.95
R2109:Sh3gl3 UTSW 7 82270800 missense possibly damaging 0.94
R5752:Sh3gl3 UTSW 7 82174948 intron probably benign
R6881:Sh3gl3 UTSW 7 82306970 missense possibly damaging 0.95
R7162:Sh3gl3 UTSW 7 82284142 missense probably benign
R7570:Sh3gl3 UTSW 7 82285077 missense probably benign
R7710:Sh3gl3 UTSW 7 82284086 missense possibly damaging 0.83
R8029:Sh3gl3 UTSW 7 82270883 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAAACACGGTGTTGCTATCTGC -3'
(R):5'- GCCAGCCGAACTGCTCAGATTTAC -3'

Sequencing Primer
(F):5'- TTGCTATCTGCGCGAGC -3'
(R):5'- TCAGATTTACAACCGCCAGGG -3'
Posted On2014-04-24