Incidental Mutation 'R1228:Fli1'
ID175035
Institutional Source Beutler Lab
Gene Symbol Fli1
Ensembl Gene ENSMUSG00000016087
Gene NameFriend leukemia integration 1
SynonymsSIC-1, EWSR2, Sic1, Fli-1
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R1228 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32422204-32542861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32423843 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 431 (Y431C)
Ref Sequence ENSEMBL: ENSMUSP00000016231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]
Predicted Effect probably damaging
Transcript: ENSMUST00000016231
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: Y431C

DomainStartEndE-ValueType
SAM_PNT 114 198 2.52e-38 SMART
ETS 280 365 1.22e-57 SMART
low complexity region 402 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183767
SMART Domains Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087

DomainStartEndE-ValueType
SAM_PNT 81 165 2.52e-38 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Fli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Fli1 APN 9 32423940 missense probably benign 0.31
IGL01329:Fli1 APN 9 32424101 missense probably damaging 1.00
IGL01925:Fli1 APN 9 32465831 missense probably damaging 1.00
IGL01951:Fli1 APN 9 32461364 missense probably damaging 0.99
IGL01963:Fli1 APN 9 32424207 nonsense probably null
IGL02889:Fli1 APN 9 32465696 missense probably damaging 1.00
R0026:Fli1 UTSW 9 32476584 missense probably damaging 1.00
R0243:Fli1 UTSW 9 32423981 missense probably benign 0.00
R0279:Fli1 UTSW 9 32461427 missense probably damaging 1.00
R0418:Fli1 UTSW 9 32452129 splice site probably benign
R0967:Fli1 UTSW 9 32461449 missense probably benign
R1557:Fli1 UTSW 9 32461244 splice site probably benign
R1875:Fli1 UTSW 9 32423913 missense probably benign 0.03
R3401:Fli1 UTSW 9 32461274 missense probably damaging 1.00
R3898:Fli1 UTSW 9 32476722 missense possibly damaging 0.88
R4051:Fli1 UTSW 9 32452162 missense probably benign 0.03
R6440:Fli1 UTSW 9 32423901 missense probably benign 0.07
R6901:Fli1 UTSW 9 32429925 missense probably benign 0.14
R7061:Fli1 UTSW 9 32424222 missense probably damaging 0.98
R7231:Fli1 UTSW 9 32424188 missense probably damaging 1.00
R7676:Fli1 UTSW 9 32428030 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTGGTGGACTGGCTCATGGAATG -3'
(R):5'- CAAAATGACGGACCCTGATGAGGTG -3'

Sequencing Primer
(F):5'- AGGTTCTATCCAAAAGAAAGAACATC -3'
(R):5'- CATTATGACCAAAGTGCATGGC -3'
Posted On2014-04-24