Incidental Mutation 'R1228:Clvs2'
ID175037
Institutional Source Beutler Lab
Gene Symbol Clvs2
Ensembl Gene ENSMUSG00000019785
Gene Nameclavesin 2
SynonymsRlbp1l2, A330019N05Rik
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1228 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location33512286-33624769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33622604 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 110 (N110S)
Ref Sequence ENSEMBL: ENSMUSP00000151805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019920] [ENSMUST00000160299] [ENSMUST00000161692]
Predicted Effect probably benign
Transcript: ENSMUST00000019920
AA Change: N110S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000019920
Gene: ENSMUSG00000019785
AA Change: N110S

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
SEC14 96 254 1.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159533
Predicted Effect probably benign
Transcript: ENSMUST00000160299
AA Change: N110S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125100
Gene: ENSMUSG00000019785
AA Change: N110S

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
Pfam:CRAL_TRIO 98 219 8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160756
Predicted Effect probably benign
Transcript: ENSMUST00000161692
AA Change: N110S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217704
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the SEC14/CRAL-TRIO family of proteins. A similar protein in rat is thought to function in the endosomal pathway between early endosomes and mature lysosomes. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Clvs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Clvs2 APN 10 33528463 missense probably benign 0.03
IGL02304:Clvs2 APN 10 33528447 missense probably benign 0.02
IGL02967:Clvs2 APN 10 33595788 missense probably damaging 0.98
R0085:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R0346:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R2176:Clvs2 UTSW 10 33595815 missense probably damaging 1.00
R2280:Clvs2 UTSW 10 33528500 missense probably damaging 1.00
R3413:Clvs2 UTSW 10 33622971 start gained probably benign
R4008:Clvs2 UTSW 10 33543462 missense probably damaging 1.00
R4855:Clvs2 UTSW 10 33622646 missense probably damaging 1.00
R5814:Clvs2 UTSW 10 33528507 missense probably benign 0.01
R6265:Clvs2 UTSW 10 33528515 missense possibly damaging 0.93
R6730:Clvs2 UTSW 10 33528521 missense probably damaging 1.00
R7558:Clvs2 UTSW 10 33543464 missense probably damaging 1.00
R7955:Clvs2 UTSW 10 33595812 missense possibly damaging 0.90
R8337:Clvs2 UTSW 10 33528488 missense possibly damaging 0.95
RF003:Clvs2 UTSW 10 33622925 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCAAGGGAGCCTACTCAAAGC -3'
(R):5'- TGGTCATCACTAGGCCGGACATTG -3'

Sequencing Primer
(F):5'- CTCAAAGCTCACTATGAGTTGC -3'
(R):5'- CGCACAGATGACGCTTTC -3'
Posted On2014-04-24