Incidental Mutation 'R1228:Ttbk1'
ID175043
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R1228 (G1)
Quality Score215
Status Not validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 46476712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000047034] [ENSMUST00000223818] [ENSMUST00000225808]
Predicted Effect probably null
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect probably benign
Transcript: ENSMUST00000223818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224870
Predicted Effect probably null
Transcript: ENSMUST00000225808
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGCACTGATACCGGGAAGATCAGC -3'
(R):5'- AGAAGTCTCCCAGAAAAGGGTCCAC -3'

Sequencing Primer
(F):5'- CTTGGGGGGCAATCTTGAAA -3'
(R):5'- CCATGATGACCTGTGGTCC -3'
Posted On2014-04-24