Incidental Mutation 'R1313:Gtf3c3'
ID175046
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54417778 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 488 (A488T)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Meta Mutation Damage Score 0.6542 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Dpyd G T 3: 118,899,161 probably benign Het
Ercc6 C T 14: 32,552,720 probably benign Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilrb4 C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Pet112l A G 3: 85,653,826 I550V probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Rps26-ps1 T A 8: 107,439,457 probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Vav1 G A 17: 57,309,498 probably benign Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7586:Gtf3c3 UTSW 1 54403593 missense probably damaging 1.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCATGCAAGCCTAAAGACCTGAG -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'
Posted On2014-04-24