Incidental Mutation 'R1313:Rps26-ps1'
ID175058
Institutional Source Beutler Lab
Gene Symbol Rps26-ps1
Ensembl Gene ENSMUSG00000059775
Gene Nameribosomal protein S26, pseudogene 1
SynonymsGm10070
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1313 (G1)
Quality Score119
Status Not validated
Chromosome8
Chromosomal Location107439176-107439585 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 107439457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205] [ENSMUST00000213097]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077208
SMART Domains Protein: ENSMUSP00000076447
Gene: ENSMUSG00000059775

DomainStartEndE-ValueType
Pfam:Ribosomal_S26e 1 107 2.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166615
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212102
Predicted Effect probably benign
Transcript: ENSMUST00000212205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212906
Predicted Effect probably benign
Transcript: ENSMUST00000213097
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Dpyd G T 3: 118,899,161 probably benign Het
Ercc6 C T 14: 32,552,720 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilrb4 C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Pet112l A G 3: 85,653,826 I550V probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Vav1 G A 17: 57,309,498 probably benign Het
Predicted Primers PCR Primer
(F):5'- ACGGCCTCTTTACATGGGCTTTGG -3'
(R):5'- AGAGCAAGCAGGGTTTTCTCAGC -3'

Sequencing Primer
(F):5'- TGGAGGTCGAGGTGCAG -3'
(R):5'- tttctttctctttcttccttccttc -3'
Posted On2014-04-24