Incidental Mutation 'R1313:Mocs1'
ID175066
Institutional Source Beutler Lab
Gene Symbol Mocs1
Ensembl Gene ENSMUSG00000064120
Gene Namemolybdenum cofactor synthesis 1
Synonyms3110045D15Rik
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location49428362-49455435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49454269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 464 (T464S)
Ref Sequence ENSEMBL: ENSMUSP00000133694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024797] [ENSMUST00000057610] [ENSMUST00000173033] [ENSMUST00000173362] [ENSMUST00000174647]
Predicted Effect probably benign
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057610
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172871
SMART Domains Protein: ENSMUSP00000134449
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Mob_synth_C 1 86 8.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173033
AA Change: T464S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120
AA Change: T464S

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173430
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack the cofactor molybdopterin and enzyme activities dependent on the cofactor (including sulfate oxidase and xanthine oxidase), have curly whiskers, and die between postnatal days 1 and 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Dpyd G T 3: 118,899,161 probably benign Het
Ercc6 C T 14: 32,552,720 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilrb4 C T 10: 51,480,736 T6I probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Pet112l A G 3: 85,653,826 I550V probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Rps26-ps1 T A 8: 107,439,457 probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Vav1 G A 17: 57,309,498 probably benign Het
Other mutations in Mocs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mocs1 APN 17 49435264 critical splice donor site probably null
IGL00473:Mocs1 APN 17 49433201 missense probably benign 0.01
IGL01565:Mocs1 APN 17 49452320 missense probably benign 0.00
IGL02822:Mocs1 APN 17 49439569 missense probably damaging 1.00
R0321:Mocs1 UTSW 17 49433258 missense probably damaging 1.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R2155:Mocs1 UTSW 17 49454358 missense probably damaging 1.00
R2271:Mocs1 UTSW 17 49449109 missense probably damaging 1.00
R2398:Mocs1 UTSW 17 49452834 missense probably damaging 0.99
R4669:Mocs1 UTSW 17 49454585 missense possibly damaging 0.67
R5566:Mocs1 UTSW 17 49454183 missense possibly damaging 0.92
R5751:Mocs1 UTSW 17 49449738 unclassified probably null
R6061:Mocs1 UTSW 17 49450313 missense probably damaging 1.00
R6157:Mocs1 UTSW 17 49454736 missense probably benign 0.06
R6212:Mocs1 UTSW 17 49435196 missense probably damaging 1.00
R6268:Mocs1 UTSW 17 49435155 missense probably damaging 1.00
R7047:Mocs1 UTSW 17 49452859 critical splice donor site probably null
R7270:Mocs1 UTSW 17 49449115 missense possibly damaging 0.83
R7395:Mocs1 UTSW 17 49454557 missense possibly damaging 0.56
R7522:Mocs1 UTSW 17 49435264 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCGGAATCCAAGTGCCAGACAG -3'
(R):5'- ACATGTCATACACCGTCAGGGCAG -3'

Sequencing Primer
(F):5'- AAGTGCCAGACAGTGTCTCTC -3'
(R):5'- CGTGTGCTGTCTAACTCCAGG -3'
Posted On2014-04-24