Mutagenetix > Incidental Mutation

Incidental Mutation 'R1564:Scn9a'

175077

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

039603-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1564 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66484304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1679 (F1679S)

Ref Sequence

ENSEMBL: ENSMUSP00000131711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably damaging
Transcript: ENSMUST00000100063
AA Change: F1681S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: F1681S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100064
AA Change: F1690S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: F1690S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112354
AA Change: F1679S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: F1679S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152740

Predicted Effect

probably damaging
Transcript: ENSMUST00000164384
AA Change: F1690S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: F1690S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: F1679S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: F1679S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	T	C	13: 19,729,300		noncoding transcript	Het
Abca13	C	T	11: 9,434,316	Q3923*	probably null	Het
Abcc12	T	A	8: 86,517,486	T1013S	probably benign	Het
Acad9	T	C	3: 36,089,429	I558T	possibly damaging	Het
Agbl4	C	A	4: 110,955,564		probably null	Het
Akr1b3	C	T	6: 34,306,535		probably null	Het
Aktip	A	G	8: 91,131,081	M1T	probably null	Het
Apc	G	T	18: 34,315,149	Q1665H	probably benign	Het
Arfgef3	T	C	10: 18,591,704	D1916G	probably damaging	Het
Arhgef11	T	C	3: 87,702,510	V365A	probably benign	Het
Bank1	C	A	3: 136,213,841	E265*	probably null	Het
Bbs7	A	T	3: 36,575,795	D578E	probably damaging	Het
Bin3	T	C	14: 70,134,769	F172L	probably damaging	Het
Bves	A	G	10: 45,369,281	D350G	probably benign	Het
Cacna1h	A	T	17: 25,377,861	C80*	probably null	Het
Cacna2d4	T	C	6: 119,241,195	F164L	possibly damaging	Het
Cenpj	T	C	14: 56,552,066	D842G	probably benign	Het
Col12a1	C	A	9: 79,613,840	R2781L	probably damaging	Het
Cyp2c68	A	T	19: 39,735,580	C213*	probably null	Het
Defb33	T	A	8: 20,897,581	C45S	possibly damaging	Het
Dolk	A	T	2: 30,285,621	N137K	probably damaging	Het
Fam171b	G	A	2: 83,880,284	E767K	probably damaging	Het
Fbxl20	A	T	11: 98,098,486	D189E	probably damaging	Het
Gm10643	A	T	8: 84,064,482	M1K	probably null	Het
Gm572	T	G	4: 148,651,186	I24S	possibly damaging	Het
Gnpda1	A	G	18: 38,338,089		probably null	Het
Helz2	G	T	2: 181,233,228	N1824K	probably benign	Het
Insl3	G	T	8: 71,690,291	A99S	possibly damaging	Het
Lpin2	G	A	17: 71,225,060	V137I	probably benign	Het
Lrrc9	A	G	12: 72,487,053	E1032G	probably damaging	Het
Macf1	T	C	4: 123,459,357	T1510A	probably benign	Het
Mnd1	T	C	3: 84,116,431	E116G	probably benign	Het
Mycbp2	A	G	14: 103,169,851		probably null	Het
Myoz3	G	A	18: 60,580,842	S23L	probably benign	Het
Napsa	G	T	7: 44,586,649	V371F	probably damaging	Het
Nefh	T	C	11: 4,939,878	T914A	unknown	Het
Neurod2	A	T	11: 98,327,424	C305S	probably damaging	Het
Nmnat3	T	C	9: 98,354,166		probably null	Het
Nuf2	A	G	1: 169,498,793	V463A	unknown	Het
Olfml1	A	T	7: 107,571,139	T78S	possibly damaging	Het
Olfr1199	A	T	2: 88,756,656	N6K	possibly damaging	Het
Olfr1228	G	T	2: 89,249,672	N7K	probably benign	Het
Olfr61	G	A	7: 140,638,054	V118I	probably benign	Het
Olfr800	T	C	10: 129,660,015	F70L	probably benign	Het
Opcml	G	A	9: 28,903,316	C288Y	probably damaging	Het
Oprl1	T	C	2: 181,718,940	I222T	possibly damaging	Het
Pcsk5	A	G	19: 17,654,756	Y349H	probably damaging	Het
Pla2g4d	C	A	2: 120,268,903	R706L	possibly damaging	Het
Pmm1	A	G	15: 81,956,200	Y55H	probably damaging	Het
Polb	A	G	8: 22,630,341		probably null	Het
Pom121l2	T	C	13: 21,983,353	I598T	possibly damaging	Het
Pxmp2	C	T	5: 110,281,196		probably null	Het
Rbm39	G	T	2: 156,154,257	L403I	probably benign	Het
Rec8	T	C	14: 55,622,275		probably null	Het
Reck	T	C	4: 43,912,061	I190T	probably benign	Het
Rer1	A	T	4: 155,075,593	I166N	probably damaging	Het
Rgs17	T	A	10: 5,842,567	K60*	probably null	Het
Ripor2	C	T	13: 24,675,785	T152M	probably damaging	Het
Scgb1b2	A	T	7: 31,291,775		probably benign	Het
Scn3a	C	A	2: 65,514,635	R503M	probably damaging	Het
Scn4a	C	A	11: 106,345,541	D298Y	probably benign	Het
Scyl3	G	T	1: 163,939,984		probably null	Het
Sec23ip	A	G	7: 128,766,281		probably null	Het
She	C	T	3: 89,849,614	A325V	possibly damaging	Het
Skint2	T	G	4: 112,625,998	M200R	probably damaging	Het
Slc17a5	A	T	9: 78,578,699	C35S	probably damaging	Het
Slc25a24	T	A	3: 109,163,503	S393T	probably damaging	Het
Slc6a19	C	T	13: 73,686,124	V320M	probably damaging	Het
Snap91	T	C	9: 86,792,196	D579G	possibly damaging	Het
Spats2l	C	T	1: 57,946,224	R479C	probably damaging	Het
Syngr3	G	C	17: 24,686,668		probably null	Het
Tas2r107	A	C	6: 131,659,822	I88R	probably damaging	Het
Them7	A	T	2: 105,297,914	N80I	probably damaging	Het
Tmprss7	C	T	16: 45,662,153		probably null	Het
Tnrc6b	A	G	15: 80,880,168	N624D	possibly damaging	Het
Trpm2	T	G	10: 77,942,999	I378L	probably benign	Het
Ttn	C	A	2: 76,724,532	W30676L	probably damaging	Het
Ttn	A	G	2: 76,944,040	V2220A	unknown	Het
Uba6	T	C	5: 86,154,407	T134A	probably benign	Het
Vmn2r55	A	G	7: 12,684,751	S81P	probably damaging	Het
Zfp616	T	A	11: 74,084,722	S606T	probably damaging	Het
Zfp653	C	A	9: 22,055,859	A577S	probably damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
R9443:Scn9a	UTSW	2	66565209	missense	probably damaging	1.00
R9590:Scn9a	UTSW	2	66483984	missense	probably benign	0.05
R9612:Scn9a	UTSW	2	66533364	missense	probably damaging	1.00
R9617:Scn9a	UTSW	2	66562465	missense	probably damaging	1.00
R9717:Scn9a	UTSW	2	66526658	missense	probably benign
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CAACGCTGAAGTTCTCCAGGATGAC -3'
(R):5'- ACGCTGCTCTTTGCTCTGATGATG -3'

Sequencing Primer
(F):5'- TTCTCCAGGATGACAGCAATG -3'
(R):5'- GATGATGTCCCTTCCTGCG -3'

Posted On

2014-04-24