Incidental Mutation 'R1564:Arhgef11'
ID175092
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87702510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000122166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect probably benign
Transcript: ENSMUST00000039476
AA Change: V365A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: V365A

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129113
AA Change: V325A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: V325A

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142799
Predicted Effect probably benign
Transcript: ENSMUST00000152006
AA Change: V365A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: V365A

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTTTGGTTGACACCAGCTATG -3'
(R):5'- TGCTGTCTGGTAGGCTACAAGTACG -3'

Sequencing Primer
(F):5'- TGGTTGACACCAGCTATGAAAGG -3'
(R):5'- GTTCTTTCTCTGTCCTTGAGATG -3'
Posted On2014-04-24