Incidental Mutation 'R1564:Pcsk5'
ID175161
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17654756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 349 (Y349H)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably damaging
Transcript: ENSMUST00000025618
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: Y349H

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050715
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: Y349H

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R7986:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTGCCGTATGATACTCACAC -3'
(R):5'- CCCCATTTGCATCATGGGAACAGAG -3'

Sequencing Primer
(F):5'- CGTATGATACTCACACTCATGTTC -3'
(R):5'- tgggaacagagattgtgttgg -3'
Posted On2014-04-24